| Title: | Analyses of Phylogenetics and Evolution |
|---|---|
| Description: | Functions for reading, writing, plotting, and manipulating phylogenetic trees, analyses of comparative data in a phylogenetic framework, ancestral character analyses, analyses of diversification and macroevolution, computing distances from DNA sequences, reading and writing nucleotide sequences as well as importing from BioConductor, and several tools such as Mantel's test, generalized skyline plots, graphical exploration of phylogenetic data (alex, trex, kronoviz), estimation of absolute evolutionary rates and clock-like trees using mean path lengths and penalized likelihood, dating trees with non-contemporaneous sequences, translating DNA into AA sequences, and assessing sequence alignments. Phylogeny estimation can be done with the NJ, BIONJ, ME, MVR, SDM, and triangle methods, and several methods handling incomplete distance matrices (NJ*, BIONJ*, MVR*, and the corresponding triangle method). Some functions call external applications (PhyML, Clustal, T-Coffee, Muscle, MAFFT) whose results are returned into R. |
| Authors: | Emmanuel Paradis [aut, cre, cph] (ORCID: <https://orcid.org/0000-0003-3092-2199>), Simon Blomberg [aut, cph] (ORCID: <https://orcid.org/0000-0003-1062-0839>), Ben Bolker [aut, cph] (ORCID: <https://orcid.org/0000-0002-2127-0443>), Joseph Brown [aut, cph] (ORCID: <https://orcid.org/0000-0002-3835-8062>), Santiago Claramunt [aut, cph] (ORCID: <https://orcid.org/0000-0002-8926-5974>), Julien Claude [aut, cph] (ORCID: <https://orcid.org/0000-0002-9267-1228>), Hoa Sien Cuong [aut, cph], Richard Desper [aut, cph], Gilles Didier [aut, cph] (ORCID: <https://orcid.org/0000-0003-0596-9112>), Benoit Durand [aut, cph], Julien Dutheil [aut, cph] (ORCID: <https://orcid.org/0000-0001-7753-4121>), RJ Ewing [aut, cph], Olivier Gascuel [aut, cph], Thomas Guillerme [aut, cph] (ORCID: <https://orcid.org/0000-0003-4325-1275>), Christoph Heibl [aut, cph] (ORCID: <https://orcid.org/0000-0002-7655-3299>), Anthony Ives [aut, cph] (ORCID: <https://orcid.org/0000-0001-9375-9523>), Bradley Jones [aut, cph] (ORCID: <https://orcid.org/0000-0003-4498-1069>), Franz Krah [aut, cph] (ORCID: <https://orcid.org/0000-0001-7866-7508>), Daniel Lawson [aut, cph] (ORCID: <https://orcid.org/0000-0002-5311-6213>), Vincent Lefort [aut, cph], Pierre Legendre [aut, cph] (ORCID: <https://orcid.org/0000-0002-3838-3305>), Jim Lemon [aut, cph], Guillaume Louvel [aut, cph] (ORCID: <https://orcid.org/0000-0002-7745-0785>), Federico Marotta [aut, cph], Eric Marcon [aut, cph] (ORCID: <https://orcid.org/0000-0002-5249-321X>), Rosemary McCloskey [aut, cph] (ORCID: <https://orcid.org/0000-0002-9772-8553>), Johan Nylander [aut, cph], Rainer Opgen-Rhein [aut, cph], Andrei-Alin Popescu [aut, cph], Manuela Royer-Carenzi [aut, cph], Klaus Schliep [aut, cph] (ORCID: <https://orcid.org/0000-0003-2941-0161>), Korbinian Strimmer [aut, cph] (ORCID: <https://orcid.org/0000-0001-7917-2056>), Damien de Vienne [aut, cph] (ORCID: <https://orcid.org/0000-0001-9532-5251>) |
| Maintainer: | Emmanuel Paradis <[email protected]> |
| License: | GPL-2 | GPL-3 |
| Version: | 5.8-3 |
| Built: | 2026-06-24 08:26:19 UTC |
| Source: | https://github.com/emmanuelparadis/ape |
ape provides functions for reading, writing, manipulating, analysing, and simulating phylogenetic trees and DNA sequences, computing DNA distances, translating into AA sequences, estimating trees with distance-based methods, and a range of methods for comparative analyses and analysis of diversification. Functionalities are also provided for programming new phylogenetic methods.
The complete list of functions can be displayed with
library(help = ape).
More information on ape can be found at https://emmanuelparadis.github.io.
Emmanuel Paradis, Ben Bolker, Julien Claude, Hoa Sien Cuong, Richard Desper, Benoit Durand, Julien Dutheil, Olivier Gascuel, Christoph Heibl, Daniel Lawson, Vincent Lefort, Pierre Legendre, Jim Lemon, Yvonnick Noel, Johan Nylander, Rainer Opgen-Rhein, Andrei-Alin Popescu, Klaus Schliep, Korbinian Strimmer, Damien de Vienne
Maintainer: Emmanuel Paradis <[email protected]>
Paradis, E. (2012) Analysis of Phylogenetics and Evolution with R (Second Edition). New York: Springer.
Popescu, A.-A., Huber, K. T. and Paradis, E. (2012) ape 3.0: new tools for distance based phylogenetics and evolutionary analysis in R. Bioinformatics, 28, 1536–1537.
Paradis, E. and Schliep, K. (2019) ape 5.0: an environment for modern phylogenetics and evolutionary analyses in R. Bioinformatics, 35, 526–528.
These functions help to create and manipulate AA sequences.
## S3 method for class 'AAbin' print(x, ...) ## S3 method for class 'AAbin' x[i, j, drop = FALSE] ## S3 method for class 'AAbin' c(..., recursive = FALSE) ## S3 method for class 'AAbin' rbind(...) ## S3 method for class 'AAbin' cbind(..., check.names = TRUE, fill.with.Xs = FALSE, quiet = FALSE) ## S3 method for class 'AAbin' as.character(x, ...) ## S3 method for class 'AAbin' labels(object, ...) ## S3 method for class 'AAbin' image(x, what, col, bg = "white", xlab = "", ylab = "", show.labels = TRUE, cex.lab = 1, legend = TRUE, grid = FALSE, show.aa = FALSE, aa.cex = 1, aa.font = 1, aa.col = "black", scheme = "Ape_AA",...) as.AAbin(x, ...) ## S3 method for class 'character' as.AAbin(x, ...) ## S3 method for class 'list' as.AAbin(x, ...) ## S3 method for class 'AAString' as.AAbin(x, ...) ## S3 method for class 'AAStringSet' as.AAbin(x, ...) ## S3 method for class 'AAMultipleAlignment' as.AAbin(x, ...) ## S3 method for class 'AAbin' as.list(x, ...) ## S3 method for class 'AAbin' as.matrix(x, ...) ## S3 method for class 'AAbin' as.phyDat(x, ...) dist.aa(x, pairwise.deletion = FALSE, scaled = FALSE) AAsubst(x)## S3 method for class 'AAbin' print(x, ...) ## S3 method for class 'AAbin' x[i, j, drop = FALSE] ## S3 method for class 'AAbin' c(..., recursive = FALSE) ## S3 method for class 'AAbin' rbind(...) ## S3 method for class 'AAbin' cbind(..., check.names = TRUE, fill.with.Xs = FALSE, quiet = FALSE) ## S3 method for class 'AAbin' as.character(x, ...) ## S3 method for class 'AAbin' labels(object, ...) ## S3 method for class 'AAbin' image(x, what, col, bg = "white", xlab = "", ylab = "", show.labels = TRUE, cex.lab = 1, legend = TRUE, grid = FALSE, show.aa = FALSE, aa.cex = 1, aa.font = 1, aa.col = "black", scheme = "Ape_AA",...) as.AAbin(x, ...) ## S3 method for class 'character' as.AAbin(x, ...) ## S3 method for class 'list' as.AAbin(x, ...) ## S3 method for class 'AAString' as.AAbin(x, ...) ## S3 method for class 'AAStringSet' as.AAbin(x, ...) ## S3 method for class 'AAMultipleAlignment' as.AAbin(x, ...) ## S3 method for class 'AAbin' as.list(x, ...) ## S3 method for class 'AAbin' as.matrix(x, ...) ## S3 method for class 'AAbin' as.phyDat(x, ...) dist.aa(x, pairwise.deletion = FALSE, scaled = FALSE) AAsubst(x)
x, object
|
an object of class |
i, j
|
indices of the rows and/or columns to select or to drop. They may be numeric, logical, or character (in the same way than for standard R objects). |
drop |
logical; if |
recursive |
logical; whether to go down lists and concatenate its elements. |
check.names |
a logical specifying whether to check the rownames before binding the columns (see details). |
fill.with.Xs |
a logical indicating whether to keep all
possible individuals as indicating by the rownames, and eventually
filling the missing data with X (ignored if |
quiet |
a logical to switch off warning messages when some rows are dropped. |
what |
a vector of characters specifying the amino acids to
visualize; actually set by the argument |
col |
a vector of colours. If missing, this is set to “red”, “yellow” and “blue”. |
bg |
the colour used for AA codes not among |
xlab |
the label for the x-axis; none by default. |
ylab |
Idem for the y-axis. Note that by default, the labels of the sequences are printed on the y-axis (see next option). |
show.labels |
a logical controlling whether the sequence labels are
printed ( |
cex.lab |
a single numeric controlling the size of the sequence
labels. Use |
legend |
a logical controlling whether the legend is plotted
( |
grid |
a logical controlling whether to draw a grid ( |
show.aa |
a logical controlling whether to show the AA symbols ( |
aa.cex, aa.font, aa.col
|
control the aspect of the AA symbols
(ignored if the previous is |
scheme |
a predefined color scheme. For amino acid options are "Ape_AA", "Zappo_AA", "Clustal" and "Hydrophobicity", for nucleotides "Ape_NT" and "RY_NT". |
pairwise.deletion |
a logical indicating whether to delete the sites with missing data in a pairwise way. The default is to delete the sites with at least one missing data for all sequences. |
scaled |
a logical value specifying whether to scale the number of AA differences by the sequence length. |
... |
further arguments to be passed to or from other methods. |
These functions help to manipulate amino acid sequences of class
"AAbin". These objects are stored in vectors, matrices, or lists
which can be manipulated with the [ operator.
There is a conversion function to and from characters.
The function dist.aa computes the number of AA differences
between each pair of sequences in a matrix; this can be scaled by the
sequence length. See the function dist.ml in
phangorn for evolutionary distances with AA sequences.
The function AAsubst returns the indices of the polymorphic sites
(similar to seg.sites for DNA sequences; see examples below).
The two functions cbind.AAbin and rbind.AAbin work in the
same way than the similar methods for the class "DNAbin": see
cbind.DNAbin for more explanations about their respective
behaviours.
an object of class "AAbin", "character",
"dist", or "numeric", depending on the function.
Emmanuel Paradis, Franz Krah
data(woodmouse) AA <- trans(woodmouse, 2) seg.sites(woodmouse) AAsubst(AA)data(woodmouse) AA <- trans(woodmouse, 2) seg.sites(woodmouse) AAsubst(AA)
ace estimates ancestral character states, and the associated
uncertainty, for continuous and discrete characters. If marginal
= TRUE, a marginal estimation procedure is used. With this method,
the likelihood values at a given node are computed using only the
information from the tips (and branches) descending from this node.
The present implementation of marginal reconstruction for discrete characters does not calculate the most likely state for each node, integrating over all the possible states, over all the other nodes in the tree, in proportion to their probability. For more details, see the Note below.
logLik, deviance, and AIC are generic functions
used to extract the log-likelihood, the deviance, or the Akaike
information criterion of a fitted object. If no such values are
available, NULL is returned.
anova is another generic function which is used to compare
nested models: the significance of the additional parameter(s) is
tested with likelihood ratio tests. You must ensure that the models
are effectively nested (if they are not, the results will be
meaningless). It is better to list the models from the smallest to the
largest.
ace(x, phy, type = "continuous", method = if (type == "continuous") "REML" else "ML", CI = TRUE, model = if (type == "continuous") "BM" else "ER", scaled = TRUE, kappa = 1, corStruct = NULL, ip = 0.1, use.expm = FALSE, use.eigen = TRUE, marginal = FALSE) ## S3 method for class 'ace' print(x, digits = 4, ...) ## S3 method for class 'ace' logLik(object, ...) ## S3 method for class 'ace' deviance(object, ...) ## S3 method for class 'ace' AIC(object, ..., k = 2) ## S3 method for class 'ace' anova(object, ...)ace(x, phy, type = "continuous", method = if (type == "continuous") "REML" else "ML", CI = TRUE, model = if (type == "continuous") "BM" else "ER", scaled = TRUE, kappa = 1, corStruct = NULL, ip = 0.1, use.expm = FALSE, use.eigen = TRUE, marginal = FALSE) ## S3 method for class 'ace' print(x, digits = 4, ...) ## S3 method for class 'ace' logLik(object, ...) ## S3 method for class 'ace' deviance(object, ...) ## S3 method for class 'ace' AIC(object, ..., k = 2) ## S3 method for class 'ace' anova(object, ...)
x |
a vector or a factor; an object of class |
phy |
an object of class |
type |
the variable type; either |
method |
a character specifying the method used for
estimation. Four choices are possible: |
CI |
a logical specifying whether to return the 95% confidence intervals of the ancestral state estimates (for continuous characters) or the likelihood of the different states (for discrete ones). |
model |
a character specifying the model (ignored if |
scaled |
a logical specifying whether to scale the contrast
estimate (used only if |
kappa |
a positive value giving the exponent transformation of the branch lengths (see details). |
corStruct |
if |
ip |
the initial value(s) used for the ML estimation procedure
when |
use.expm |
a logical specifying whether to use the package
expm to compute the matrix exponential (relevant only if
|
use.eigen |
a logical (relevant if |
marginal |
a logical (relevant if |
digits |
the number of digits to be printed. |
object |
an object of class |
k |
a numeric value giving the penalty per estimated parameter;
the default is |
... |
further arguments passed to or from other methods. |
If type = "continuous", the default model is Brownian motion
where characters evolve randomly following a random walk. This model
can be fitted by residual maximum likelihood (the default), maximum
likelihood (Felsenstein 1973, Schluter et al. 1997), least squares
(method = "pic", Felsenstein 1985), or generalized least
squares (method = "GLS", Martins and Hansen 1997, Cunningham et
al. 1998). In the last case, the specification of phy and
model are actually ignored: it is instead given through a
correlation structure with the option corStruct.
In the setting method = "ML" and model = "BM" (this used
to be the default until ape 3.0-7) the maximum likelihood
estimation is done simultaneously on the ancestral values and the
variance of the Brownian motion process; these estimates are then used
to compute the confidence intervals in the standard way. The REML
method first estimates the ancestral value at the root (aka, the
phylogenetic mean), then the variance of the Brownian motion process
is estimated by optimizing the residual log-likelihood. The ancestral
values are finally inferred from the likelihood function giving these
two parameters. If method = "pic" or "GLS", the
confidence intervals are computed using the expected variances under
the model, so they depend only on the tree.
It could be shown that, with a continous character, REML results in unbiased estimates of the variance of the Brownian motion process while ML gives a downward bias. Therefore the former is recommanded.
For discrete characters (type = "discrete"), only maximum
likelihood estimation is available (Pagel 1994) (see MPR
for an alternative method). The model is specified through a numeric
matrix with integer values taken as indices of the parameters. The
numbers of rows and of columns of this matrix must be equal, and are
taken to give the number of states of the character. For instance,
matrix(c(0, 1, 1, 0), 2) will represent a model with two
character states and equal rates of transition, matrix(c(0, 1,
2, 0), 2) a model with unequal rates, matrix(c(0, 1, 1, 1, 0,
1, 1, 1, 0), 3) a model with three states and equal rates of
transition (the diagonal is always ignored). There are short-cuts to
specify these models: "ER" is an equal-rates model (e.g., the
first and third examples above), "ARD" is an
all-rates-different model (the second example), and "SYM" is a
symmetrical model (e.g., matrix(c(0, 1, 2, 1, 0, 3, 2, 3, 0),
3)). If a short-cut is used, the number of states is determined from
the data.
By default, the likelihood of the different ancestral states of
discrete characters are computed with a joint estimation procedure
using a procedure similar to the one described in Pupko et al. (2000).
If marginal = TRUE, a marginal estimation procedure is used
(this was the only choice until ape 3.1-1). With this method,
the likelihood values at a given node are computed using only the
information from the tips (and branches) descending from this node.
With the joint estimation, all information is used for each node. The
difference between these two methods is further explained in
Felsenstein (2004, pp. 259-260) and in Yang (2006, pp. 121-126). The
present implementation of the joint estimation uses a “two-pass”
algorithm which is much faster than stochastic mapping while the
estimates of both methods are very close.
With discrete characters it is necessary to compute the exponential of
the rate matrix. The only possibility until ape 3.0-7 was the
function matexpo in ape. If use.expm = TRUE
and use.eigen = FALSE, the function expm,
in the package of the same name, is used. matexpo is faster but
quite inaccurate for large and/or asymmetric matrices. In case of
doubt, use the latter. Since ape 3.0-10, it is possible to use
an eigen decomposition avoiding the need to compute the matrix
exponential; see details in Lebl (2013, sect. 3.8.3). This is much
faster and is now the default.
Since version 5.2 of ape, ace can take state uncertainty
for discrete characters into account: this should be coded with R's
NA only. More details:
https://www.mail-archive.com/[email protected]/msg05286.html
an object of class "ace" with the following elements:
ace |
if |
CI95 |
if |
sigma2 |
if |
rates |
if |
se |
if |
index.matrix |
if |
loglik |
if |
lik.anc |
if |
call |
the function call. |
Liam Revell points out that for discrete characters the ancestral
likelihood values returned with marginal = FALSE are actually
the marginal estimates, while setting marginal = TRUE returns
the conditional (scaled) likelihoods of the subtree:
http://blog.phytools.org/2015/05/about-how-acemarginaltrue-does-not.html
Emmanuel Paradis, Ben Bolker
Cunningham, C. W., Omland, K. E. and Oakley, T. H. (1998) Reconstructing ancestral character states: a critical reappraisal. Trends in Ecology & Evolution, 13, 361–366.
Felsenstein, J. (1973) Maximum likelihood estimation of evolutionary trees from continuous characters. American Journal of Human Genetics, 25, 471–492.
Felsenstein, J. (1985) Phylogenies and the comparative method. American Naturalist, 125, 1–15.
Felsenstein, J. (2004) Inferring Phylogenies. Sunderland: Sinauer Associates.
Lebl, J. (2013) Notes on Diffy Qs: Differential Equations for Engineers. https://www.jirka.org/diffyqs/.
Martins, E. P. and Hansen, T. F. (1997) Phylogenies and the comparative method: a general approach to incorporating phylogenetic information into the analysis of interspecific data. American Naturalist, 149, 646–667.
Pagel, M. (1994) Detecting correlated evolution on phylogenies: a general method for the comparative analysis of discrete characters. Proceedings of the Royal Society of London. Series B. Biological Sciences, 255, 37–45.
Pupko, T., Pe'er, I, Shamir, R., and Graur, D. (2000) A fast algorithm for joint reconstruction of ancestral amino acid sequences. Molecular Biology and Evolution, 17, 890–896.
Schluter, D., Price, T., Mooers, A. O. and Ludwig, D. (1997) Likelihood of ancestor states in adaptive radiation. Evolution, 51, 1699–1711.
Yang, Z. (2006) Computational Molecular Evolution. Oxford: Oxford University Press.
MPR, corBrownian, compar.ou,
anova
Reconstruction of ancestral sequences can be done with the package
phangorn (see function ?ancestral.pml).
### Some random data... data(bird.orders) x <- rnorm(23) ### Compare the three methods for continuous characters: ace(x, bird.orders) ace(x, bird.orders, method = "pic") ace(x, bird.orders, method = "GLS", corStruct = corBrownian(1, bird.orders)) ### For discrete characters: x <- factor(c(rep(0, 5), rep(1, 18))) ans <- ace(x, bird.orders, type = "d") #### Showing the likelihoods on each node: plot(bird.orders, type = "c", FALSE, label.offset = 1) co <- c("blue", "yellow") tiplabels(pch = 22, bg = co[as.numeric(x)], cex = 2, adj = 1) nodelabels(thermo = ans$lik.anc, piecol = co, cex = 0.75)### Some random data... data(bird.orders) x <- rnorm(23) ### Compare the three methods for continuous characters: ace(x, bird.orders) ace(x, bird.orders, method = "pic") ace(x, bird.orders, method = "GLS", corStruct = corBrownian(1, bird.orders)) ### For discrete characters: x <- factor(c(rep(0, 5), rep(1, 18))) ans <- ace(x, bird.orders, type = "d") #### Showing the likelihoods on each node: plot(bird.orders, type = "c", FALSE, label.offset = 1) co <- c("blue", "yellow") tiplabels(pch = 22, bg = co[as.numeric(x)], cex = 2, adj = 1) nodelabels(thermo = ans$lik.anc, piecol = co, cex = 0.75)
This function adds a horizontal bar showing the scale of the branch lengths to a plot of a phylogenetic tree on the current graphical device.
add.scale.bar(x, y, length = NULL, ask = FALSE, lwd = 1, lcol = "black", ...)add.scale.bar(x, y, length = NULL, ask = FALSE, lwd = 1, lcol = "black", ...)
x |
x location of the bar (can be left missing). |
y |
y location of the bar (can be left missing). |
length |
a numeric value giving the length of the scale bar. If none is supplied, a value is calculated from the data. |
ask |
a logical; if |
lwd |
the width of the bar. |
lcol |
the colour of the bar (use |
... |
further arguments to be passed to |
By default, the bar is placed in a corner of the graph depending on
the direction of the tree. Otherwise both x and y must
be specified (if only one is given it is ignored).
The further arguments (...) are used to format the text. They
may be font, cex, col, and so on (see examples
below, and the help page on text).
The function locator may be used to
determine the x and y arguments.
Emmanuel Paradis
plot.phylo, axisPhylo,
locator
tr <- rtree(10) layout(matrix(1:2, 2, 1)) plot(tr) add.scale.bar() plot(tr) add.scale.bar(cex = 0.7, font = 2, col = "red") layout(1)tr <- rtree(10) layout(matrix(1:2, 2, 1)) plot(tr) add.scale.bar() plot(tr) add.scale.bar(cex = 0.7, font = 2, col = "red") layout(1)
Fills missing entries from incomplete distance matrix using the additive or the ultrametric procedure (see reference for details).
additive(X) ultrametric(X)additive(X) ultrametric(X)
X |
a distance matrix or an object of class |
a distance matrix.
Andrei Popescu
Makarenkov, V. and Lapointe, F.-J. (2004) A weighted least-squares approach for inferring phylogenies from incomplete distance matrices. Bioinformatics, 20, 2113–2121.
This function helps to explore DNA alignments by zooming in. The user clicks twice defining the opposite corners of the portion which is extracted and drawn on a new window.
alex(x, ...)alex(x, ...)
x |
an object of class |
... |
further arguments to pass to |
This function works with a DNA alignment (freshly) plotted on an
interactive graphical device (i.e., not a file) with image.
After calling alex, the user clicks twice defining a rectangle
in the alignment, then this portion of the alignment is extacted and
plotted on a new window. The user can click as many times on
the alignment. The process is stopped by a right-click. If the user
clicks twice outside the alignment, a message “Try again!” is
printed.
Each time alex is called, the alignment is plotted on a new
window without closing or deleting those possibly already plotted.
In all cases, the device where x is plotted is the active
window after the operation. It should not be closed during the
whole process.
NULL
Emmanuel Paradis
## Not run: data(woodmouse) image(woodmouse) alex(woodmouse) ## End(Not run)## Not run: data(woodmouse) image(woodmouse) alex(woodmouse) ## End(Not run)
Comparison of DNA sequence sets, particularly when aligned.
## S3 method for class 'DNAbin' all.equal(target, current, plot = FALSE, ...)## S3 method for class 'DNAbin' all.equal(target, current, plot = FALSE, ...)
target, current
|
the two sets of sequences to be compared. |
plot |
a logical value specifying whether to plot the sites that are different (only if the labels of both alignments are the same). |
... |
further arguments passed to |
If the two sets of DNA sequences are exactly identical, this function
returns TRUE. Otherwise, a detailed comparison is made only if
the labels (i.e., rownames) of target and current are the
same (possibly in different orders). In all other cases, a brief
description of the differences is returned (sometimes with
recommendations to make further comparisons).
This function can be used for testing in programs using
isTRUE (see examples below).
TRUE if the two sets are identical; a list with two elements
(message and different.sites) if a detailed comparison is done; or a
vector of mode character.
Emmanuel Paradis
image.DNAbin, clustal,
checkAlignment,
the generic function: all.equal
data(woodmouse) woodm2 <- woodmouse woodm2[1, c(1:5, 10:12, 30:40)] <- as.DNAbin("g") res <- all.equal(woodmouse, woodm2, plot = TRUE) str(res) ## if used for testing in R programs: isTRUE(all.equal(woodmouse, woodmouse)) # TRUE isTRUE(all.equal(woodmouse, woodm2)) # FALSE all.equal(woodmouse, woodmouse[15:1, ]) all.equal(woodmouse, woodmouse[-1, ]) all.equal(woodmouse, woodmouse[, -1]) ## Not run: ## To run the followings you need internet and Clustal and MUSCLE ## correctly installed. ## Data from Johnson et al. (2006, Science) refs <- paste("DQ082", 505:545, sep = "") DNA <- read.GenBank(refs) DNA.clustal <- clustal(DNA) DNA.muscle <- muscle(DNA) isTRUE(all.equal(DNA.clustal, DNA.muscle)) # FALSE all.equal(DNA.clustal, DNA.muscle, TRUE) ## End(Not run)data(woodmouse) woodm2 <- woodmouse woodm2[1, c(1:5, 10:12, 30:40)] <- as.DNAbin("g") res <- all.equal(woodmouse, woodm2, plot = TRUE) str(res) ## if used for testing in R programs: isTRUE(all.equal(woodmouse, woodmouse)) # TRUE isTRUE(all.equal(woodmouse, woodm2)) # FALSE all.equal(woodmouse, woodmouse[15:1, ]) all.equal(woodmouse, woodmouse[-1, ]) all.equal(woodmouse, woodmouse[, -1]) ## Not run: ## To run the followings you need internet and Clustal and MUSCLE ## correctly installed. ## Data from Johnson et al. (2006, Science) refs <- paste("DQ082", 505:545, sep = "") DNA <- read.GenBank(refs) DNA.clustal <- clustal(DNA) DNA.muscle <- muscle(DNA) isTRUE(all.equal(DNA.clustal, DNA.muscle)) # FALSE all.equal(DNA.clustal, DNA.muscle, TRUE) ## End(Not run)
This function makes a global comparison of two phylogenetic trees.
## S3 method for class 'phylo' all.equal(target, current, use.edge.length = TRUE, use.tip.label = TRUE, index.return = FALSE, tolerance = .Machine$double.eps^0.5, scale = NULL, ...)## S3 method for class 'phylo' all.equal(target, current, use.edge.length = TRUE, use.tip.label = TRUE, index.return = FALSE, tolerance = .Machine$double.eps^0.5, scale = NULL, ...)
target |
an object of class |
current |
an object of class |
use.edge.length |
if |
use.tip.label |
if |
index.return |
if |
tolerance |
the numeric tolerance used to compare the branch lengths. |
scale |
a positive number, comparison of branch lengths is made after scaling (i.e., dividing) them by this number. |
... |
further arguments passed to or from other methods. |
A single phylogenetic tree may have several representations in the Newick
format and in the "phylo" class of objects used in ‘ape’. One
aim of the present function is to be able to identify whether two
objects of class "phylo" represent the same phylogeny.
A logical value, or a two-column matrix.
The algorithm used here does not work correctly for the comparison of
topologies (i.e., ignoring tip labels) of unrooted trees. This also
affects unique.multiPhylo which calls the present function. See:
https://www.mail-archive.com/[email protected]/msg01445.html.
Benoît Durand [email protected]
all.equal for the generic R function, comparePhylo
### maybe the simplest example of two representations ### for the same rooted tree...: t1 <- read.tree(text = "(a:1,b:1);") t2 <- read.tree(text = "(b:1,a:1);") all.equal(t1, t2) ### ... compare with this: identical(t1, t2) ### one just slightly more complicated...: t3 <- read.tree(text = "((a:1,b:1):1,c:2);") t4 <- read.tree(text = "(c:2,(a:1,b:1):1);") all.equal(t3, t4) # == all.equal.phylo(t3, t4) ### ... here we force the comparison as lists: all.equal.list(t3, t4)### maybe the simplest example of two representations ### for the same rooted tree...: t1 <- read.tree(text = "(a:1,b:1);") t2 <- read.tree(text = "(b:1,a:1);") all.equal(t1, t2) ### ... compare with this: identical(t1, t2) ### one just slightly more complicated...: t3 <- read.tree(text = "((a:1,b:1):1,c:2);") t4 <- read.tree(text = "(c:2,(a:1,b:1):1);") all.equal(t3, t4) # == all.equal.phylo(t3, t4) ### ... here we force the comparison as lists: all.equal.list(t3, t4)
This function displays in the console or a file an alignment of DNA or AAsequences. The first sequence is printed on the first row and the bases of the other sequences are replaced by dots if they are identical with the first sequence.
alview(x, file = "", uppercase = TRUE, showpos = TRUE)alview(x, file = "", uppercase = TRUE, showpos = TRUE)
x |
a matrix or a list of DNA sequences (class |
file |
a character string giving the name of the file where to print the sequences; by default, they are printed in the console. |
uppercase |
a logical specifying whether to print the bases as uppercase letters. |
showpos |
either a logical value specifying whether to display the site positions, or a numeric vector giving these positions (see examples). |
The first line of the output shows the position of the last column of the printed alignment.
Emmanuel Paradis
DNAbin, image.DNAbin, alex,
clustal, checkAlignment, all.equal.DNAbin
data(woodmouse) alview(woodmouse[, 1:50]) alview(woodmouse[, 1:50], uppercase = FALSE) ## display only some sites: j <- c(10, 49, 125, 567) # just random x <- woodmouse[, j] alview(x, showpos = FALSE) # no site position displayed alview(x, showpos = j) ## Not run: alview(woodmouse, file = "woodmouse.txt") ## End(Not run)data(woodmouse) alview(woodmouse[, 1:50]) alview(woodmouse[, 1:50], uppercase = FALSE) ## display only some sites: j <- c(10, 49, 125, 567) # just random x <- woodmouse[, j] alview(x, showpos = FALSE) # no site position displayed alview(x, showpos = j) ## Not run: alview(woodmouse, file = "woodmouse.txt") ## End(Not run)
These functions transform a set of DNA sequences among various internal formats.
as.alignment(x) as.DNAbin(x, ...) ## S3 method for class 'character' as.DNAbin(x, ...) ## S3 method for class 'list' as.DNAbin(x, ...) ## S3 method for class 'alignment' as.DNAbin(x, ...) ## S3 method for class 'DNAString' as.DNAbin(x, ...) ## S3 method for class 'DNAStringSet' as.DNAbin(x, ...) ## S3 method for class 'PairwiseAlignmentsSingleSubject' as.DNAbin(x, ...) ## S3 method for class 'DNAMultipleAlignment' as.DNAbin(x, ...) ## S3 method for class 'DNAbin' as.character(x, ...)as.alignment(x) as.DNAbin(x, ...) ## S3 method for class 'character' as.DNAbin(x, ...) ## S3 method for class 'list' as.DNAbin(x, ...) ## S3 method for class 'alignment' as.DNAbin(x, ...) ## S3 method for class 'DNAString' as.DNAbin(x, ...) ## S3 method for class 'DNAStringSet' as.DNAbin(x, ...) ## S3 method for class 'PairwiseAlignmentsSingleSubject' as.DNAbin(x, ...) ## S3 method for class 'DNAMultipleAlignment' as.DNAbin(x, ...) ## S3 method for class 'DNAbin' as.character(x, ...)
x |
a matrix or a list containing the DNA sequences, or an object
of class |
... |
further arguments to be passed to or from other methods. |
For as.alignment, the sequences given as argument should be
stored as matrices or lists of single-character strings (the format
used in ape before version 1.10). The returned object is in the
format used in the package seqinr to store aligned sequences.
as.DNAbin is a generic function with methods so that it works
with sequences stored into vectors, matrices, or lists. It can convert
some S4 classes from the package Biostrings in BioConductor. For
consistency within ape, this uses an S3-style syntax. To convert
objects of class "DNAStringSetList", see the examples.
as.character is a generic function: the present method
converts objects of class "DNAbin" into the format used
before ape 1.10 (matrix of single characters, or list of vectors
of single characters). This function must be used first to convert
objects of class "DNAbin" into the class "alignment".
an object of class "alignment" in the case of
"as.alignment"; an object of class "DNAbin" in the case
of "as.DNAbin"; a matrix of mode character or a list containing
vectors of mode character in the case of "as.character".
Emmanuel Paradis
DNAbin, read.dna,
read.GenBank, write.dna
data(woodmouse) x <- as.character(woodmouse) x[, 1:20] str(as.alignment(x)) identical(as.DNAbin(x), woodmouse) ### conversion from BioConductor: ## Not run: if (require(Biostrings)) { data(phiX174Phage) X <- as.DNAbin(phiX174Phage) ## base frequencies: base.freq(X) # from ape alphabetFrequency(phiX174Phage) # from Biostrings ### for objects of class "DNAStringSetList" X <- lapply(x, as.DNAbin) # a list of lists ### to put all sequences in a single list: X <- unlist(X, recursive = FALSE) class(X) <- "DNAbin" } ## End(Not run)data(woodmouse) x <- as.character(woodmouse) x[, 1:20] str(as.alignment(x)) identical(as.DNAbin(x), woodmouse) ### conversion from BioConductor: ## Not run: if (require(Biostrings)) { data(phiX174Phage) X <- as.DNAbin(phiX174Phage) ## base frequencies: base.freq(X) # from ape alphabetFrequency(phiX174Phage) # from Biostrings ### for objects of class "DNAStringSetList" X <- lapply(x, as.DNAbin) # a list of lists ### to put all sequences in a single list: X <- unlist(X, recursive = FALSE) class(X) <- "DNAbin" } ## End(Not run)
bitsplits returns the bipartitions (aka splits) for a single
tree or a list of trees. If at least one tree is rooted, an error is
returned.
countBipartitions returns the frequencies of the bipartitions
from a reference tree (phy) observed in a list of trees (X), all unrooted.
as.bitsplits and as.prop.part are generic functions for
converting between the "bitsplits" and "prop.part"
classes.
bitsplits(x) countBipartitions(phy, X) as.bitsplits(x) ## S3 method for class 'prop.part' as.bitsplits(x) ## S3 method for class 'bitsplits' print(x, ...) ## S3 method for class 'bitsplits' sort(x, decreasing = FALSE, ...) as.prop.part(x, ...) ## S3 method for class 'bitsplits' as.prop.part(x, include.trivial = FALSE, ...)bitsplits(x) countBipartitions(phy, X) as.bitsplits(x) ## S3 method for class 'prop.part' as.bitsplits(x) ## S3 method for class 'bitsplits' print(x, ...) ## S3 method for class 'bitsplits' sort(x, decreasing = FALSE, ...) as.prop.part(x, ...) ## S3 method for class 'bitsplits' as.prop.part(x, include.trivial = FALSE, ...)
x |
an object of the appropriate class. |
phy |
an object of class |
X |
an object of class |
decreasing |
a logical value to sort the bipartitions in increasing (the default) or decreasing order of their frequency. |
include.trivial |
a logical value specifying whether to include the trivial split with all tips in the returned object. |
... |
further arguments passed to or from other methods. |
These functions count bipartitions as defined by internal branches, so
they work only with unrooted trees. The structure of the class
"bitsplits" is described in a separate document on ape's web
site.
This data structure has a memory requirement proportional to
, so it can be inefficient with large trees (> 1000 tips),
particularly if they are very different (i.e., with few shared
splits). In any case, an error occurs if the product of the number of
tips by the number of nodes is greater than (~2.1
billion). A warning message is given if the tree(s) has(ve) more than
46,341 tips. It may happen that the search for splits is interrupted
if the data structure is full (with a warning message).
bitsplits, as.bitsplits, and sort return an object
of class "bitsplits".
countBipartitions returns a vector of integers.
as.prop.part returns an object of class "prop.part".
Emmanuel Paradis
tr <- rtree(20) pp <- prop.part(tr) as.bitsplits(pp) ## works only with unrooted trees (ape 5.5): countBipartitions(rtree(10, rooted = FALSE), rmtree(100, 10, rooted = FALSE))tr <- rtree(20) pp <- prop.part(tr) as.bitsplits(pp) ## works only with unrooted trees (ape 5.5): countBipartitions(rtree(10, rooted = FALSE), rmtree(100, 10, rooted = FALSE))
These functions convert objects between the classes "phylo" and
"matching".
as.matching(x, ...) ## S3 method for class 'phylo' as.matching(x, labels = TRUE, ...) ## S3 method for class 'matching' as.phylo(x, ...)as.matching(x, ...) ## S3 method for class 'phylo' as.matching(x, labels = TRUE, ...) ## S3 method for class 'matching' as.phylo(x, ...)
x |
an object to convert as an object of class |
labels |
a logical specifying whether the tip and node labels should be included in the returned matching. |
... |
further arguments to be passed to or from other methods. |
A matching is a representation where each tip and each node are given a number, and sibling groups are grouped in a “matching pair” (see Diaconis and Holmes 1998, for details). This coding system can be used only for binary (fully dichotomous) trees.
Diaconis and Holmes (1998) gave some conventions to insure that a given tree has a unique representation as a matching. I have tried to follow them in the present functions.
as.matching returns an object of class "matching" with
the following component:
matching |
a two-column numeric matrix where the columns represent the sibling pairs. |
tip.label |
(optional) a character vector giving the tip labels
where the ith element is the label of the tip numbered i in
|
node.label |
(optional) a character vector giving the node
labels in the same order than in |
as.phylo.matching returns an object of class "phylo".
Branch lengths are not supported.
Emmanuel Paradis
Diaconis, P. W. and Holmes, S. P. (1998) Matchings and phylogenetic trees. Proceedings of the National Academy of Sciences USA, 95, 14600–14602.
data(bird.orders) m <- as.matching(bird.orders) str(m) m tr <- as.phylo(m) all.equal(tr, bird.orders, use.edge.length = FALSE)data(bird.orders) m <- as.matching(bird.orders) str(m) m tr <- as.phylo(m) all.equal(tr, bird.orders, use.edge.length = FALSE)
as.phylo is a generic function which converts an object into a
tree of class "phylo". There are currently two methods for
objects of class "hclust" and of class "phylog"
(implemented in the package ade4). The default method is for any
object inheriting the class "phylo" which is returned unchanged.
as.hclust.phylo is a method of the generic
as.hclust which converts an object of class
"phylo" into one of class "hclust". This can used to
convert an object of class "phylo" into one of class
"dendrogram" (see examples).
as.network and as.igraph convert trees of class
"phylo" into these respective classes defined in the packages
of the same names (where the generics are defined).
old2new.phylo and new2old.phylo are utility functions
for converting between the old and new coding of the class
"phylo".
as.phylo(x, ...) ## Default S3 method: as.phylo(x, ...) ## S3 method for class 'hclust' as.phylo(x, ...) ## S3 method for class 'phylog' as.phylo(x, ...) ## S3 method for class 'phylo' as.hclust(x, ...) old2new.phylo(phy) new2old.phylo(phy) ## S3 method for class 'phylo' as.network(x, directed = is.rooted(x), ...) ## S3 method for class 'phylo' as.igraph(x, directed = is.rooted(x), use.labels = TRUE, ...)as.phylo(x, ...) ## Default S3 method: as.phylo(x, ...) ## S3 method for class 'hclust' as.phylo(x, ...) ## S3 method for class 'phylog' as.phylo(x, ...) ## S3 method for class 'phylo' as.hclust(x, ...) old2new.phylo(phy) new2old.phylo(phy) ## S3 method for class 'phylo' as.network(x, directed = is.rooted(x), ...) ## S3 method for class 'phylo' as.igraph(x, directed = is.rooted(x), use.labels = TRUE, ...)
x |
an object to be converted into another class. |
directed |
a logical value: should the network be directed? By default, this depends on whether the tree is rooted or not. |
use.labels |
a logical specifying whether to use labels to build
the network of class |
... |
further arguments to be passed to or from other methods. |
phy |
an object of class |
An object of class "hclust", "phylo", "network",
or "igraph".
In an object of class "hclust", the height gives the
distance between the two sets that are being agglomerated. So these
distances are divided by two when setting the branch lengths of a
phylogenetic tree.
Emmanuel Paradis
hclust, as.hclust,
dendrogram, as.phylo.formula
data(bird.orders) hc <- as.hclust(bird.orders) tr <- as.phylo(hc) all.equal(bird.orders, tr) # TRUE ### shows the three plots for tree objects: dend <- as.dendrogram(hc) layout(matrix(c(1:3, 3), 2, 2)) plot(bird.orders, font = 1) plot(hc) par(mar = c(8, 0, 0, 0)) # leave space for the labels plot(dend) ### how to get identical plots with ### plot.phylo and plot.dendrogram: layout(matrix(1:2, 2, 1)) plot(bird.orders, font = 1, no.margin = TRUE, label.offset = 0.4) par(mar = c(0, 0, 0, 8)) plot(dend, horiz = TRUE) layout(1) ## Not run: ### convert into networks: if (require(network)) { x <- as.network(rtree(10)) print(x) plot(x, vertex.cex = 1:4) plot(x, displaylabels = TRUE) } tr <- rtree(5) if (require(igraph)) { print((x <- as.igraph(tr))) plot(x) print(as.igraph(tr, TRUE, FALSE)) print(as.igraph(tr, FALSE, FALSE)) } ## End(Not run)data(bird.orders) hc <- as.hclust(bird.orders) tr <- as.phylo(hc) all.equal(bird.orders, tr) # TRUE ### shows the three plots for tree objects: dend <- as.dendrogram(hc) layout(matrix(c(1:3, 3), 2, 2)) plot(bird.orders, font = 1) plot(hc) par(mar = c(8, 0, 0, 0)) # leave space for the labels plot(dend) ### how to get identical plots with ### plot.phylo and plot.dendrogram: layout(matrix(1:2, 2, 1)) plot(bird.orders, font = 1, no.margin = TRUE, label.offset = 0.4) par(mar = c(0, 0, 0, 8)) plot(dend, horiz = TRUE) layout(1) ## Not run: ### convert into networks: if (require(network)) { x <- as.network(rtree(10)) print(x) plot(x, vertex.cex = 1:4) plot(x, displaylabels = TRUE) } tr <- rtree(5) if (require(igraph)) { print((x <- as.igraph(tr))) plot(x) print(as.igraph(tr, TRUE, FALSE)) print(as.igraph(tr, FALSE, FALSE)) } ## End(Not run)
The function as.phylo.formula (short form as.phylo)
builds a phylogenetic tree (an object of class phylo) from
a set of nested taxonomic variables.
## S3 method for class 'formula' as.phylo(x, data = parent.frame(), collapse = TRUE, ...)## S3 method for class 'formula' as.phylo(x, data = parent.frame(), collapse = TRUE, ...)
x |
a right-side formula describing the taxonomic relationship:
|
data |
the data.frame where to look for the variables (default to user's workspace). |
collapse |
a logical value specifying whether to collapse single nodes in the returned tree (see details). |
... |
further arguments to be passed from other methods. |
Taxonomic variables must be nested and passed in the correct order:
the higher clade must be on the left of the formula, for instance
~Order/Family/Genus/Species. In most cases, the resulting tree
will be unresolved and will contain polytomies.
The option collapse = FALSE has for effect to add single nodes
in the tree when a given higher level has only one element in the
level below (e.g., a monospecific genus); see the example below.
an object of class "phylo".
Julien Dutheil [email protected], Eric Marcon and Klaus Schliep
as.phylo, read.tree for a
description of "phylo" objects, multi2di
data(carnivora) frm <- ~SuperFamily/Family/Genus/Species tr <- as.phylo(frm, data = carnivora, collapse=FALSE) tr$edge.length <- rep(1, nrow(tr$edge)) plot(tr, show.node.label=TRUE) Nnode(tr) ## compare with: Nnode(as.phylo(frm, data = carnivora, collapse = FALSE))data(carnivora) frm <- ~SuperFamily/Family/Genus/Species tr <- as.phylo(frm, data = carnivora, collapse=FALSE) tr$edge.length <- rep(1, nrow(tr$edge)) plot(tr, show.node.label=TRUE) Nnode(tr) ## compare with: Nnode(as.phylo(frm, data = carnivora, collapse = FALSE))
This function adds a scaled axis on the side of a phylogeny plot.
axisPhylo(side = NULL, root.time = NULL, backward = TRUE, ...)axisPhylo(side = NULL, root.time = NULL, backward = TRUE, ...)
side |
a numeric value specifying the side where the axis is plotted: 1: below, 2: left, 3: above, 4: right. By default, this is taken from the direction of the plot. |
root.time |
the time assigned to the root node of the tree. By
default, this is taken from the |
backward |
a logical value; if TRUE, the most distant tip from the root is considered as the origin of the time scale; if FALSE, this is the root node. |
... |
further arguments to be passed to |
The further arguments (...) are used to format the axis. They
may be font, cex, col, las, and so on (see
the help pages on axis and
par).
Emmanuel Paradis, Klaus Schliep
plot.phylo, add.scale.bar,
axis, par
tr <- rtree(30) ch <- rcoal(30) plot(ch) axisPhylo() plot(tr, "c", FALSE, direction = "u") axisPhylo(las = 1)tr <- rtree(30) ch <- rcoal(30) plot(ch) axisPhylo() plot(tr, "c", FALSE, direction = "u") axisPhylo(las = 1)
This function computes the balance of a phylogenetic tree, that is for each node of the tree the numbers of descendants (i.e. tips) on each of its daughter-branch. The tree must be fully dichotomous.
balance(phy)balance(phy)
phy |
an object of class |
a numeric matrix with two columns and one row for each node of the
tree. The columns give the numbers of descendants on each
daughter-branches (the order of both columns being arbitrary). If the
phylogeny phy has an element node.label, this is used as
rownames for the returned matrix; otherwise the numbers (of mode
character) of the matrix edge of phy are used as rownames.
Emmanuel Paradis
Aldous, D. J. (2001) Stochastic models and descriptive statistics for phylogenetic trees, from Yule to today. Statistical Science, 16, 23–34.
base.freq computes the frequencies (absolute or relative) of
the four DNA bases (adenine, cytosine, guanine, and thymidine) from a
sample of sequences.
GC.content computes the proportion of G+C (using the previous
function). All missing or unknown sites are ignored.
Ftab computes the contingency table with the absolute
frequencies of the DNA bases from a pair of sequences.
base.freq(x, freq = FALSE, all = FALSE) GC.content(x) Ftab(x, y = NULL)base.freq(x, freq = FALSE, all = FALSE) GC.content(x) Ftab(x, y = NULL)
x |
a vector, a matrix, or a list which contains the DNA sequences. |
y |
a vector with a single DNA sequence. |
freq |
a logical specifying whether to return the proportions (the default) or the absolute frequencies (counts). |
all |
a logical; by default only the counts of A, C, G, and T are
returned. If |
The base frequencies are computed over all sequences in x.
For Ftab, if the argument y is given then both x
and y are coerced as vectors and must be of equal length. If
y is not given, x must be a matrix or a list and only
the two first sequences are used.
A numeric vector with names c("a", "c", "g", "t") (and possibly
"r", "m", ...); a single numeric value; or a four by four matrix
with similar dimnames.
Emmanuel Paradis
seg.sites, nuc.div (in pegas), DNAbin
data(woodmouse) base.freq(woodmouse) base.freq(woodmouse, TRUE) base.freq(woodmouse, TRUE, TRUE) GC.content(woodmouse) Ftab(woodmouse) Ftab(woodmouse[1, ], woodmouse[2, ]) # same than above Ftab(woodmouse[14:15, ]) # between the last two sequencesdata(woodmouse) base.freq(woodmouse) base.freq(woodmouse, TRUE) base.freq(woodmouse, TRUE, TRUE) GC.content(woodmouse) Ftab(woodmouse) Ftab(woodmouse[1, ], woodmouse[2, ]) # same than above Ftab(woodmouse[14:15, ]) # between the last two sequences
This function fits by maximum likelihood a birth-death model to the combined phylogenetic and taxonomic data of a given clade. The phylogenetic data are given by a tree, and the taxonomic data by the number of species for the its tips.
bd.ext(phy, S, conditional = TRUE)bd.ext(phy, S, conditional = TRUE)
phy |
an object of class |
S |
a numeric vector giving the number of species for each tip. |
conditional |
whether probabilities should be conditioned on no extinction (mainly to compare results with previous analyses; see details). |
A re-parametrization of the birth-death model studied by Kendall (1948) so that the likelihood has to be maximized over d/b and b - d, where b is the birth rate, and d the death rate.
The standard-errors of the estimated parameters are computed using a normal approximation of the maximum likelihood estimates.
If the argument S has names, then they are matched to the tip
labels of phy. The user must be careful here since the function
requires that both series of names perfectly match, so this operation
may fail if there is a typing or syntax error. If both series of names
do not match, the values S are taken to be in the same order
than the tip labels of phy, and a warning message is issued.
Note that the function does not check that the tree is effectively ultrametric, so if it is not, the returned result may not be meaningful.
If conditional = TRUE, the probabilities of the taxonomic data
are calculated conditioned on no extinction (Rabosky et al. 2007). In
previous versions of the present function (until ape 2.6-1),
unconditional probabilities were used resulting in underestimated
extinction rate. Though it does not make much sense to use
conditional = FALSE, this option is provided to compare results
from previous analyses: if the species richnesses are relatively low,
both versions will give similar results (see examples).
Emmanuel Paradis
Paradis, E. (2003) Analysis of diversification: combining phylogenetic and taxonomic data. Proceedings of the Royal Society of London. Series B. Biological Sciences, 270, 2499–2505.
Rabosky, D. L., Donnellan, S. C., Talaba, A. L. and Lovette, I. J. (2007) Exceptional among-lineage variation in diversification rates during the radiation of Australia's most diverse vertebrate clade. Proceedings of the Royal Society of London. Series B. Biological Sciences, 274, 2915–2923.
birthdeath, branching.times,
diversi.gof, diversi.time,
ltt.plot, yule, yule.cov,
bd.time
### An example from Paradis (2003) using the avian orders: data(bird.orders) ### Number of species in each order from Sibley and Monroe (1990): S <- c(10, 47, 69, 214, 161, 17, 355, 51, 56, 10, 39, 152, 6, 143, 358, 103, 319, 23, 291, 313, 196, 1027, 5712) bd.ext(bird.orders, S) bd.ext(bird.orders, S, FALSE) # same than older versions### An example from Paradis (2003) using the avian orders: data(bird.orders) ### Number of species in each order from Sibley and Monroe (1990): S <- c(10, 47, 69, 214, 161, 17, 355, 51, 56, 10, 39, 152, 6, 143, 358, 103, 319, 23, 291, 313, 196, 1027, 5712) bd.ext(bird.orders, S) bd.ext(bird.orders, S, FALSE) # same than older versions
This function fits a used-defined time-dependent birth-death model.
bd.time(phy, birth, death, BIRTH = NULL, DEATH = NULL, ip, lower, upper, fast = FALSE, boot = 0, trace = 0)bd.time(phy, birth, death, BIRTH = NULL, DEATH = NULL, ip, lower, upper, fast = FALSE, boot = 0, trace = 0)
phy |
an object of class |
birth |
either a numeric (if speciation rate is assumed constant), or a (vectorized) function specifying how the birth (speciation) probability changes through time (see details). |
death |
id. for extinction probability. |
BIRTH |
(optional) a vectorized function giving the primitive
of |
DEATH |
id. for |
ip |
a numeric vector used as initial values for the estimation procedure. If missing, these values are guessed. |
lower, upper
|
the lower and upper bounds of the parameters. If missing, these values are guessed. |
fast |
a logical value specifying whether to use faster integration (see details). |
boot |
the number of bootstrap replicates to assess the confidence intervals of the parameters. Not run by default. |
trace |
an integer value. If non-zero, the fitting procedure is
printed every ' |
Details on how to specify the birth and death functions and their
primitives can be found in the help page of yule.time.
The model is fitted by minimizing the least squares deviation between
the observed and the predicted distributions of branching times. These
computations rely heavily on numerical integrations. If fast =
FALSE, integrations are done with R's integrate
function. If fast = TRUE, a faster but less accurate function
provided in ape is used. If fitting a complex model to a large
phylogeny, a strategy might be to first use the latter option, and
then to use the estimates as starting values with fast = FALSE.
A list with the following components:
par: a vector of estimates with names taken from the parameters in the specified functions.
SS: the minimized sum of squares.
convergence: output convergence criterion from
nlminb.
message: id.
iterations: id.
evaluations: id.
Emmanuel Paradis
Paradis, E. (2011) Time-dependent speciation and extinction from phylogenies: a least squares approach. Evolution, 65, 661–672.
ltt.plot, birthdeath,
yule.time, LTT
set.seed(3) tr <- rbdtree(0.1, 0.02) bd.time(tr, 0, 0) # fits a simple BD model bd.time(tr, 0, 0, ip = c(.1, .01)) # 'ip' is useful here ## the classic logistic: birth.logis <- function(a, b) 1/(1 + exp(-a*t - b)) ## Not run: bd.time(tr, birth.logis, 0, ip = c(0, -2, 0.01)) ## slow to get: ## $par ## a b death ## -0.003486961 -1.995983179 0.016496454 ## ## $SS ## [1] 20.73023 ## End(Not run)set.seed(3) tr <- rbdtree(0.1, 0.02) bd.time(tr, 0, 0) # fits a simple BD model bd.time(tr, 0, 0, ip = c(.1, .01)) # 'ip' is useful here ## the classic logistic: birth.logis <- function(a, b) 1/(1 + exp(-a*t - b)) ## Not run: bd.time(tr, birth.logis, 0, ip = c(0, -2, 0.01)) ## slow to get: ## $par ## a b death ## -0.003486961 -1.995983179 0.016496454 ## ## $SS ## [1] 20.73023 ## End(Not run)
binaryPGLMM performs linear regression for binary phylogenetic data, estimating regression coefficients with approximate standard errors. It simultaneously estimates the strength of phylogenetic signal in the residuals and gives an approximate conditional likelihood ratio test for the hypothesis that there is no signal. Therefore, when applied without predictor (independent) variables, it gives a test for phylogenetic signal for binary data. The method uses a GLMM approach, alternating between penalized quasi-likelihood (PQL) to estimate the "mean components" and restricted maximum likelihood (REML) to estimate the "variance components" of the model.
binaryPGLMM.sim is a companion function that simulates binary phylogenetic data of the same structure analyzed by binaryPGLMM.
binaryPGLMM(formula, data = list(), phy, s2.init = 0.1, B.init = NULL, tol.pql = 10^-6, maxit.pql = 200, maxit.reml = 100) binaryPGLMM.sim(formula, data = list(), phy, s2 = NULL, B = NULL, nrep = 1) ## S3 method for class 'binaryPGLMM' print(x, digits = max(3, getOption("digits") - 3), ...)binaryPGLMM(formula, data = list(), phy, s2.init = 0.1, B.init = NULL, tol.pql = 10^-6, maxit.pql = 200, maxit.reml = 100) binaryPGLMM.sim(formula, data = list(), phy, s2 = NULL, B = NULL, nrep = 1) ## S3 method for class 'binaryPGLMM' print(x, digits = max(3, getOption("digits") - 3), ...)
formula |
a two-sided linear formula object describing the fixed-effects of the model; for example, Y ~ X. |
data |
a data frame containing the variables named in formula. |
phy |
a phylogenetic tree as an object of class "phylo". |
s2.init |
an initial estimate of s2, the scaling component of the variance in the PGLMM. A value of s2 = 0 implies no phylogenetic signal. Note that the variance-covariance matrix given by the phylogeny phy is scaled to have determinant = 1. |
B.init |
initial estimates of B, the matrix containing regression coefficients in the model. This matrix must have dim(B.init)=c(p+1,1), where p is the number of predictor (independent) variables; the first element of B corresponds to the intercept, and the remaining elements correspond in order to the predictor (independent) variables in the model. |
tol.pql |
a control parameter dictating the tolerance for convergence for the PQL optimization. |
maxit.pql |
a control parameter dictating the maximum number of iterations for the PQL optimization. |
maxit.reml |
a control parameter dictating the maximum number of iterations for the REML optimization. |
x |
an object of class "binaryPGLMM". |
s2 |
in binaryPGLMM.sim, value of s2. See s2.init. |
B |
in binaryPGLMM.sim, value of B, the matrix containing regression coefficients in the model. See B.init. |
nrep |
in binaryPGLMM.sim, number of compete data sets produced. |
digits |
the number of digits to print. |
... |
further arguments passed to |
The function estimates parameters for the model
where is a variance-covariance matrix derived from a phylogeny (typically under the assumption of Brownian motion evolution). Although mathematically there is no requirement for to be ultrametric, forcing into ultrametric form can aide in the interpretation of the model, because in regression for binary dependent variables, only the off-diagonal elements (i.e., covariances) of matrix are biologically meaningful (see Ives & Garland 2014).
The function converts a phylo tree object into a variance-covariance matrix, and further standardizes this matrix to have determinant = 1. This in effect standardizes the interpretation of the scalar s2. Although mathematically not required, it is a very good idea to standardize the predictor (independent) variables to have mean 0 and variance 1. This will make the function more robust and improve the interpretation of the regression coefficients. For categorical (factor) predictor variables, you will need to construct 0-1 dummy variables, and these should not be standardized (for obvious reasons).
The estimation method alternates between PQL to obtain estimates of the mean components of the model (this is the standard approach to estimating GLMs) and REML to obtain estimates of the variance components. This method gives relatively fast and robust estimation. Nonetheless, the estimates of the coefficients B will generally be upwards bias, as is typical of estimation for binary data. The standard errors of B are computed from the PQL results conditional on the estimate of s2 and therefore should tend to be too small. The function returns an approximate P-value for the hypothesis of no phylogenetic signal in the residuals (i.e., H0:s2 = 0) using an approximate likelihood ratio test based on the conditional REML likelihood (rather than the marginal likelihood). Simulations have shown that these P-values tend to be high (giving type II errors: failing to identify variances that in fact are statistically significantly different from zero).
It is a good idea to confirm statistical inferences using parametric bootstrapping, and the companion function binaryPGLMM.sim gives a simply tool for this. See Examples below.
An object of class "binaryPGLMM".
formula |
formula specifying the regression model. |
B |
estimates of the regression coefficients. |
B.se |
approximate PQL standard errors of the regression coefficients. |
B.cov |
approximate PQL covariance matrix for the regression coefficients. |
B.zscore |
approximate PQL Z scores for the regression coefficients. |
B.pvalue |
approximate PQL tests for the regression coefficients being different from zero. |
s2 |
phylogenetic signal measured as the scalar magnitude of the phylogenetic variance-covariance matrix s2 * V. |
P.H0.s2 |
approximate likelihood ratio test of the hypothesis H0 that s2 = 0. This test is based on the conditional REML (keeping the regression coefficients fixed) and is prone to inflated type 1 errors. |
mu |
for each data point y, the estimate of p that y = 1. |
b |
for each data point y, the estimate of inverse.logit(p). |
X |
the predictor (independent) variables returned in matrix form (including 1s in the first column). |
H |
residuals of the form b + (Y - mu)/(mu * (1 - mu)). |
B.init |
the user-provided initial estimates of B. If B.init is not provided, these are estimated using glm() assuming no phylogenetic signal. The glm() estimates can generate convergence problems, so using small values (e.g., 0.01) is more robust but slower. |
VCV |
the standardized phylogenetic variance-covariance matrix. |
V |
estimate of the covariance matrix of H. |
convergeflag |
flag for cases when convergence failed. |
iteration |
number of total iterations performed. |
converge.test.B |
final tolerance for B. |
converge.test.s2 |
final tolerance for s2. |
rcondflag |
number of times B is reset to 0.01. This is done when rcond(V) < 10^(-10), which implies that V cannot be inverted. |
Y |
in binaryPGLMM.sim, the simulated values of Y. |
Anthony R. Ives
Ives, A. R. and Helmus, M. R. (2011) Generalized linear mixed models for phylogenetic analyses of community structure. Ecological Monographs, 81, 511–525.
Ives, A. R. and Garland, T., Jr. (2014) Phylogenetic regression for binary dependent variables. Pages 231–261 in L. Z. Garamszegi, editor. Modern Phylogenetic Comparative Methods and Their Application in Evolutionary Biology. Springer-Verlag, Berlin Heidelberg.
package pez and its function communityPGLMM;
package phylolm and its function phyloglm;
package MCMCglmm
## Illustration of binaryPGLMM() with simulated data # Generate random phylogeny n <- 100 phy <- compute.brlen(rtree(n=n), method = "Grafen", power = 1) # Generate random data and standardize to have mean 0 and variance 1 X1 <- rTraitCont(phy, model = "BM", sigma = 1) X1 <- (X1 - mean(X1))/var(X1) # Simulate binary Y sim.dat <- data.frame(Y=array(0, dim=n), X1=X1, row.names=phy$tip.label) sim.dat$Y <- binaryPGLMM.sim(Y ~ X1, phy=phy, data=sim.dat, s2=.5, B=matrix(c(0,.25),nrow=2,ncol=1), nrep=1)$Y # Fit model binaryPGLMM(Y ~ X1, phy=phy, data=sim.dat) ## Not run: # Compare with phyloglm() library(phylolm) summary(phyloglm(Y ~ X1, phy=phy, data=sim.dat)) # Compare with glm() that does not account for phylogeny summary(glm(Y ~ X1, data=sim.dat, family="binomial")) # Compare with logistf() that does not account # for phylogeny but is less biased than glm() library(logistf) logistf(Y ~ X1, data=sim.dat) # Compare with MCMCglmm library(MCMCglmm) V <- vcv(phy) V <- V/max(V) detV <- exp(determinant(V)$modulus[1]) V <- V/detV^(1/n) invV <- Matrix(solve(V),sparse=T) sim.dat$species <- phy$tip.label rownames(invV) <- sim.dat$species nitt <- 43000 thin <- 10 burnin <- 3000 prior <- list(R=list(V=1, fix=1), G=list(G1=list(V=1, nu=1000, alpha.mu=0, alpha.V=1))) summary(MCMCglmm(Y ~ X1, random=~species, ginvers=list(species=invV), data=sim.dat, slice=TRUE, nitt=nitt, thin=thin, burnin=burnin, family="categorical", prior=prior, verbose=FALSE)) ## Examine bias in estimates of B1 and s2 from binaryPGLMM with # simulated data. Note that this will take a while. Reps = 1000 s2 <- 0.4 B1 <- 1 meanEsts <- data.frame(n = Inf, B1 = B1, s2 = s2, Pr.s2 = 1, propconverged = 1) for (n in c(160, 80, 40, 20)) { meanEsts.n <- data.frame(B1 = 0, s2 = 0, Pr.s2 = 0, convergefailure = 0) for (rep in 1:Reps) { phy <- compute.brlen(rtree(n = n), method = "Grafen", power = 1) X <- rTraitCont(phy, model = "BM", sigma = 1) X <- (X - mean(X))/var(X) sim.dat <- data.frame(Y = array(0, dim = n), X = X, row.names = phy$tip.label) sim <- binaryPGLMM.sim(Y ~ 1 + X, phy = phy, data = sim.dat, s2 = s2, B = matrix(c(0,B1), nrow = 2, ncol = 1), nrep = 1) sim.dat$Y <- sim$Y z <- binaryPGLMM(Y ~ 1 + X, phy = phy, data = sim.dat) meanEsts.n[rep, ] <- c(z$B[2], z$s2, z$P.H0.s2, z$convergeflag == "converged") } converged <- meanEsts.n[,4] meanEsts <- rbind(meanEsts, c(n, mean(meanEsts.n[converged==1,1]), mean(meanEsts.n[converged==1,2]), mean(meanEsts.n[converged==1, 3] < 0.05), mean(converged))) } meanEsts # Results output for B1 = 0.5, s2 = 0.4; n-Inf gives the values used to # simulate the data # n B1 s2 Pr.s2 propconverged # 1 Inf 1.000000 0.4000000 1.00000000 1.000 # 2 160 1.012719 0.4479946 0.36153072 0.993 # 3 80 1.030876 0.5992027 0.24623116 0.995 # 4 40 1.110201 0.7425203 0.13373860 0.987 # 5 20 1.249886 0.8774708 0.05727377 0.873 ## Examine type I errors for estimates of B0 and s2 from binaryPGLMM() # with simulated data. Note that this will take a while. Reps = 1000 s2 <- 0 B0 <- 0 B1 <- 0 H0.tests <- data.frame(n = Inf, B0 = B0, s2 = s2, Pr.B0 = .05, Pr.s2 = .05, propconverged = 1) for (n in c(160, 80, 40, 20)) { ests.n <- data.frame(B1 = 0, s2 = 0, Pr.B0 = 0, Pr.s2 = 0, convergefailure = 0) for (rep in 1:Reps) { phy <- compute.brlen(rtree(n = n), method = "Grafen", power = 1) X <- rTraitCont(phy, model = "BM", sigma = 1) X <- (X - mean(X))/var(X) sim.dat <- data.frame(Y = array(0, dim = n), X = X, row.names = phy$tip.label) sim <- binaryPGLMM.sim(Y ~ 1, phy = phy, data = sim.dat, s2 = s2, B = matrix(B0, nrow = 1, ncol = 1), nrep = 1) sim.dat$Y <- sim$Y z <- binaryPGLMM(Y ~ 1, phy = phy, data = sim.dat) ests.n[rep, ] <- c(z$B[1], z$s2, z$B.pvalue, z$P.H0.s2, z$convergeflag == "converged") } converged <- ests.n[,5] H0.tests <- rbind(H0.tests, c(n, mean(ests.n[converged==1,1]), mean(ests.n[converged==1,2]), mean(ests.n[converged==1, 3] < 0.05), mean(ests.n[converged==1, 4] < 0.05), mean(converged))) } H0.tests # Results for type I errors for B0 = 0 and s2 = 0; n-Inf gives the values # used to simulate the data. These results show that binaryPGLMM() tends to # have lower-than-nominal p-values; fewer than 0.05 of the simulated # data sets have H0:B0=0 and H0:s2=0 rejected at the alpha=0.05 level. # n B0 s2 Pr.B0 Pr.s2 propconverged # 1 Inf 0.0000000000 0.00000000 0.05000000 0.05000000 1.000 # 2 160 -0.0009350357 0.07273163 0.02802803 0.04804805 0.999 # 3 80 -0.0085831477 0.12205876 0.04004004 0.03403403 0.999 # 4 40 0.0019303847 0.25486307 0.02206620 0.03711133 0.997 # 5 20 0.0181394905 0.45949266 0.02811245 0.03313253 0.996 ## End(Not run)## Illustration of binaryPGLMM() with simulated data # Generate random phylogeny n <- 100 phy <- compute.brlen(rtree(n=n), method = "Grafen", power = 1) # Generate random data and standardize to have mean 0 and variance 1 X1 <- rTraitCont(phy, model = "BM", sigma = 1) X1 <- (X1 - mean(X1))/var(X1) # Simulate binary Y sim.dat <- data.frame(Y=array(0, dim=n), X1=X1, row.names=phy$tip.label) sim.dat$Y <- binaryPGLMM.sim(Y ~ X1, phy=phy, data=sim.dat, s2=.5, B=matrix(c(0,.25),nrow=2,ncol=1), nrep=1)$Y # Fit model binaryPGLMM(Y ~ X1, phy=phy, data=sim.dat) ## Not run: # Compare with phyloglm() library(phylolm) summary(phyloglm(Y ~ X1, phy=phy, data=sim.dat)) # Compare with glm() that does not account for phylogeny summary(glm(Y ~ X1, data=sim.dat, family="binomial")) # Compare with logistf() that does not account # for phylogeny but is less biased than glm() library(logistf) logistf(Y ~ X1, data=sim.dat) # Compare with MCMCglmm library(MCMCglmm) V <- vcv(phy) V <- V/max(V) detV <- exp(determinant(V)$modulus[1]) V <- V/detV^(1/n) invV <- Matrix(solve(V),sparse=T) sim.dat$species <- phy$tip.label rownames(invV) <- sim.dat$species nitt <- 43000 thin <- 10 burnin <- 3000 prior <- list(R=list(V=1, fix=1), G=list(G1=list(V=1, nu=1000, alpha.mu=0, alpha.V=1))) summary(MCMCglmm(Y ~ X1, random=~species, ginvers=list(species=invV), data=sim.dat, slice=TRUE, nitt=nitt, thin=thin, burnin=burnin, family="categorical", prior=prior, verbose=FALSE)) ## Examine bias in estimates of B1 and s2 from binaryPGLMM with # simulated data. Note that this will take a while. Reps = 1000 s2 <- 0.4 B1 <- 1 meanEsts <- data.frame(n = Inf, B1 = B1, s2 = s2, Pr.s2 = 1, propconverged = 1) for (n in c(160, 80, 40, 20)) { meanEsts.n <- data.frame(B1 = 0, s2 = 0, Pr.s2 = 0, convergefailure = 0) for (rep in 1:Reps) { phy <- compute.brlen(rtree(n = n), method = "Grafen", power = 1) X <- rTraitCont(phy, model = "BM", sigma = 1) X <- (X - mean(X))/var(X) sim.dat <- data.frame(Y = array(0, dim = n), X = X, row.names = phy$tip.label) sim <- binaryPGLMM.sim(Y ~ 1 + X, phy = phy, data = sim.dat, s2 = s2, B = matrix(c(0,B1), nrow = 2, ncol = 1), nrep = 1) sim.dat$Y <- sim$Y z <- binaryPGLMM(Y ~ 1 + X, phy = phy, data = sim.dat) meanEsts.n[rep, ] <- c(z$B[2], z$s2, z$P.H0.s2, z$convergeflag == "converged") } converged <- meanEsts.n[,4] meanEsts <- rbind(meanEsts, c(n, mean(meanEsts.n[converged==1,1]), mean(meanEsts.n[converged==1,2]), mean(meanEsts.n[converged==1, 3] < 0.05), mean(converged))) } meanEsts # Results output for B1 = 0.5, s2 = 0.4; n-Inf gives the values used to # simulate the data # n B1 s2 Pr.s2 propconverged # 1 Inf 1.000000 0.4000000 1.00000000 1.000 # 2 160 1.012719 0.4479946 0.36153072 0.993 # 3 80 1.030876 0.5992027 0.24623116 0.995 # 4 40 1.110201 0.7425203 0.13373860 0.987 # 5 20 1.249886 0.8774708 0.05727377 0.873 ## Examine type I errors for estimates of B0 and s2 from binaryPGLMM() # with simulated data. Note that this will take a while. Reps = 1000 s2 <- 0 B0 <- 0 B1 <- 0 H0.tests <- data.frame(n = Inf, B0 = B0, s2 = s2, Pr.B0 = .05, Pr.s2 = .05, propconverged = 1) for (n in c(160, 80, 40, 20)) { ests.n <- data.frame(B1 = 0, s2 = 0, Pr.B0 = 0, Pr.s2 = 0, convergefailure = 0) for (rep in 1:Reps) { phy <- compute.brlen(rtree(n = n), method = "Grafen", power = 1) X <- rTraitCont(phy, model = "BM", sigma = 1) X <- (X - mean(X))/var(X) sim.dat <- data.frame(Y = array(0, dim = n), X = X, row.names = phy$tip.label) sim <- binaryPGLMM.sim(Y ~ 1, phy = phy, data = sim.dat, s2 = s2, B = matrix(B0, nrow = 1, ncol = 1), nrep = 1) sim.dat$Y <- sim$Y z <- binaryPGLMM(Y ~ 1, phy = phy, data = sim.dat) ests.n[rep, ] <- c(z$B[1], z$s2, z$B.pvalue, z$P.H0.s2, z$convergeflag == "converged") } converged <- ests.n[,5] H0.tests <- rbind(H0.tests, c(n, mean(ests.n[converged==1,1]), mean(ests.n[converged==1,2]), mean(ests.n[converged==1, 3] < 0.05), mean(ests.n[converged==1, 4] < 0.05), mean(converged))) } H0.tests # Results for type I errors for B0 = 0 and s2 = 0; n-Inf gives the values # used to simulate the data. These results show that binaryPGLMM() tends to # have lower-than-nominal p-values; fewer than 0.05 of the simulated # data sets have H0:B0=0 and H0:s2=0 rejected at the alpha=0.05 level. # n B0 s2 Pr.B0 Pr.s2 propconverged # 1 Inf 0.0000000000 0.00000000 0.05000000 0.05000000 1.000 # 2 160 -0.0009350357 0.07273163 0.02802803 0.04804805 0.999 # 3 80 -0.0085831477 0.12205876 0.04004004 0.03403403 0.999 # 4 40 0.0019303847 0.25486307 0.02206620 0.03711133 0.997 # 5 20 0.0181394905 0.45949266 0.02811245 0.03313253 0.996 ## End(Not run)
This function binds together two phylogenetic trees to give a single
object of class "phylo".
bind.tree(x, y, where = "root", position = 0, interactive = FALSE) x + ybind.tree(x, y, where = "root", position = 0, interactive = FALSE) x + y
x |
an object of class |
y |
an object of class |
where |
an integer giving the number of the node or tip of the
tree |
position |
a numeric value giving the position from the tip or
node given by |
interactive |
if |
The argument x can be seen as the receptor tree, whereas
y is the donor tree. The root of y is then grafted on a
location of x specified by where and, possibly,
position. If y has a root edge, this is added as in
internal branch in the resulting tree.
x + y is a shortcut for:
bind.tree(x, y, position = if (is.null(x$root.edge)) 0 else
x$root.edge)
If only one of the trees has no branch length, the branch lengths of the other one are ignored with a warning.
If one (or both) of the trees has no branch length, it is possible to
specify a value of 'position' to graft 'y' below the node of 'x'
specified by 'where'. In this case, the exact value of 'position' is
not important as long as it is greater than zero. The new node will be
multichotomous if 'y' has no root edge. This can be solved by giving
an arbitrary root edge to 'y' beforehand (e.g., y$root.edge <-
1): it will be deleted during the binding operation.
an object of class "phylo".
Emmanuel Paradis
### binds the two clades of bird orders treefile1 <- tempfile("tree", fileext = ".tre") treefile2 <- tempfile("tree", fileext = ".tre") cat("((Struthioniformes:21.8,Tinamiformes:21.8):4.1,", "((Craciformes:21.6,Galliformes:21.6):1.3,Anseriformes:22.9):3.0):2.1;", file = treefile1, sep = "\n") cat("(Turniciformes:27.0,(Piciformes:26.3,((Galbuliformes:24.4,", "((Bucerotiformes:20.8,Upupiformes:20.8):2.6,", "(Trogoniformes:22.1,Coraciiformes:22.1):1.3):1.0):0.6,", "(Coliiformes:24.5,(Cuculiformes:23.7,(Psittaciformes:23.1,", "(((Apodiformes:21.3,Trochiliformes:21.3):0.6,", "(Musophagiformes:20.4,Strigiformes:20.4):1.5):0.6,", "((Columbiformes:20.8,(Gruiformes:20.1,Ciconiiformes:20.1):0.7):0.8,", "Passeriformes:21.6):0.9):0.6):0.6):0.8):0.5):1.3):0.7):1.0;", file = treefile2, sep = "\n") tree.bird1 <- read.tree(treefile1) tree.bird2 <- read.tree(treefile2) unlink(c(treefile1, treefile2)) # clean-up (birds <- tree.bird1 + tree.bird2) layout(matrix(c(1, 2, 3, 3), 2, 2)) plot(tree.bird1) plot(tree.bird2) plot(birds) ### examples with random trees x <- rtree(4, tip.label = LETTERS[1:4]) y <- rtree(4, tip.label = LETTERS[5:8]) x <- makeNodeLabel(x, prefix = "x_") y <- makeNodeLabel(y, prefix = "y_") x$root.edge <- y$root.edge <- .2 z <- bind.tree(x, y, po=.2) plot(y, show.node.label = TRUE, font = 1, root.edge = TRUE) title("y") plot(x, show.node.label = TRUE, font = 1, root.edge = TRUE) title("x") plot(z, show.node.label = TRUE, font = 1, root.edge = TRUE) title("z <- bind.tree(x, y, po=.2)") ## make sure the terminal branch length is long enough: x$edge.length[x$edge[, 2] == 2] <- 0.2 z <- bind.tree(x, y, 2, .1) plot(y, show.node.label = TRUE, font = 1, root.edge = TRUE) title("y") plot(x, show.node.label = TRUE, font = 1, root.edge = TRUE) title("x") plot(z, show.node.label = TRUE, font = 1, root.edge = TRUE) title("z <- bind.tree(x, y, 2, .1)") x <- rtree(50) y <- rtree(50) x$root.edge <- y$root.edge <- .2 z <- x + y plot(y, show.tip.label = FALSE, root.edge = TRUE); axisPhylo() title("y") plot(x, show.tip.label = FALSE, root.edge = TRUE); axisPhylo() title("x") plot(z, show.tip.label = FALSE, root.edge = TRUE); axisPhylo() title("z <- x + y") layout(1)### binds the two clades of bird orders treefile1 <- tempfile("tree", fileext = ".tre") treefile2 <- tempfile("tree", fileext = ".tre") cat("((Struthioniformes:21.8,Tinamiformes:21.8):4.1,", "((Craciformes:21.6,Galliformes:21.6):1.3,Anseriformes:22.9):3.0):2.1;", file = treefile1, sep = "\n") cat("(Turniciformes:27.0,(Piciformes:26.3,((Galbuliformes:24.4,", "((Bucerotiformes:20.8,Upupiformes:20.8):2.6,", "(Trogoniformes:22.1,Coraciiformes:22.1):1.3):1.0):0.6,", "(Coliiformes:24.5,(Cuculiformes:23.7,(Psittaciformes:23.1,", "(((Apodiformes:21.3,Trochiliformes:21.3):0.6,", "(Musophagiformes:20.4,Strigiformes:20.4):1.5):0.6,", "((Columbiformes:20.8,(Gruiformes:20.1,Ciconiiformes:20.1):0.7):0.8,", "Passeriformes:21.6):0.9):0.6):0.6):0.8):0.5):1.3):0.7):1.0;", file = treefile2, sep = "\n") tree.bird1 <- read.tree(treefile1) tree.bird2 <- read.tree(treefile2) unlink(c(treefile1, treefile2)) # clean-up (birds <- tree.bird1 + tree.bird2) layout(matrix(c(1, 2, 3, 3), 2, 2)) plot(tree.bird1) plot(tree.bird2) plot(birds) ### examples with random trees x <- rtree(4, tip.label = LETTERS[1:4]) y <- rtree(4, tip.label = LETTERS[5:8]) x <- makeNodeLabel(x, prefix = "x_") y <- makeNodeLabel(y, prefix = "y_") x$root.edge <- y$root.edge <- .2 z <- bind.tree(x, y, po=.2) plot(y, show.node.label = TRUE, font = 1, root.edge = TRUE) title("y") plot(x, show.node.label = TRUE, font = 1, root.edge = TRUE) title("x") plot(z, show.node.label = TRUE, font = 1, root.edge = TRUE) title("z <- bind.tree(x, y, po=.2)") ## make sure the terminal branch length is long enough: x$edge.length[x$edge[, 2] == 2] <- 0.2 z <- bind.tree(x, y, 2, .1) plot(y, show.node.label = TRUE, font = 1, root.edge = TRUE) title("y") plot(x, show.node.label = TRUE, font = 1, root.edge = TRUE) title("x") plot(z, show.node.label = TRUE, font = 1, root.edge = TRUE) title("z <- bind.tree(x, y, 2, .1)") x <- rtree(50) y <- rtree(50) x$root.edge <- y$root.edge <- .2 z <- x + y plot(y, show.tip.label = FALSE, root.edge = TRUE); axisPhylo() title("y") plot(x, show.tip.label = FALSE, root.edge = TRUE); axisPhylo() title("x") plot(z, show.tip.label = FALSE, root.edge = TRUE); axisPhylo() title("z <- x + y") layout(1)
This function performs the BIONJ algorithm of Gascuel (1997).
bionj(X)bionj(X)
X |
a distance matrix; may be an object of class |
an object of class "phylo".
original C code by Hoa Sien Cuong and Olivier Gascuel; adapted and ported to R by Vincent Lefort [email protected]
Gascuel, O. (1997) BIONJ: an improved version of the NJ algorithm based on a simple model of sequence data. Molecular Biology and Evolution, 14:, 685–695.
nj, fastme, mvr,
bionjs, SDM, dist.dna
### From Saitou and Nei (1987, Table 1): x <- c(7, 8, 11, 13, 16, 13, 17, 5, 8, 10, 13, 10, 14, 5, 7, 10, 7, 11, 8, 11, 8, 12, 5, 6, 10, 9, 13, 8) M <- matrix(0, 8, 8) M[lower.tri(M)] <- x M <- t(M) M[lower.tri(M)] <- x dimnames(M) <- list(1:8, 1:8) tr <- bionj(M) plot(tr, "u") ### a less theoretical example data(woodmouse) trw <- bionj(dist.dna(woodmouse)) plot(trw)### From Saitou and Nei (1987, Table 1): x <- c(7, 8, 11, 13, 16, 13, 17, 5, 8, 10, 13, 10, 14, 5, 7, 10, 7, 11, 8, 11, 8, 12, 5, 6, 10, 9, 13, 8) M <- matrix(0, 8, 8) M[lower.tri(M)] <- x M <- t(M) M[lower.tri(M)] <- x dimnames(M) <- list(1:8, 1:8) tr <- bionj(M) plot(tr, "u") ### a less theoretical example data(woodmouse) trw <- bionj(dist.dna(woodmouse)) plot(trw)
This data set describes the phylogenetic relationships of the families of birds as reported by Sibley and Ahlquist (1990). Sibley and Ahlquist inferred this phylogeny from an extensive number of DNA/DNA hybridization experiments. The “tapestry” reported by these two authors (more than 1000 species out of the ca. 9000 extant bird species) generated a lot of debates.
The present tree is based on the relationships among families. A few
families were not included in the figures in Sibley and Ahlquist, and
thus are not included here as well. The branch lengths were calculated
from the values of as found in Sibley
and Ahlquist (1990, Figs. 354, 355, 356, and 369).
data(bird.families)data(bird.families)
The data are stored as an object of class "phylo" which
structure is described in the help page of the function
read.tree.
Sibley, C. G. and Ahlquist, J. E. (1990) Phylogeny and classification of birds: a study in molecular evolution. New Haven: Yale University Press.
data(bird.families) op <- par(cex = 0.3) plot(bird.families) par(op)data(bird.families) op <- par(cex = 0.3) plot(bird.families) par(op)
This data set describes the phylogenetic relationships of the orders
of birds as reported by Sibley and Ahlquist (1990). The branch lengths
were calculated from the values of as
found in Sibley and Ahlquist (1990, Fig. 353).
data(bird.orders)data(bird.orders)
The data are stored as an object of class "phylo" which
structure is described in the help page of the function
read.tree.
Sibley, C. G. and Ahlquist, J. E. (1990) Phylogeny and classification of birds: a study in molecular evolution. New Haven: Yale University Press.
data(bird.orders) plot(bird.orders)data(bird.orders) plot(bird.orders)
This function fits by maximum likelihood a birth-death model to the branching times computed from a phylogenetic tree using the method of Nee et al. (1994).
birthdeath(phy) ## S3 method for class 'birthdeath' print(x, ...)birthdeath(phy) ## S3 method for class 'birthdeath' print(x, ...)
phy |
an object of class |
x |
an object of class |
... |
further arguments passed to the |
Nee et al. (1994) used a re-parametrization of the birth-death model studied by Kendall (1948) so that the likelihood has to be maximized over d/b and b - d, where b is the birth rate, and d the death rate. This is the approach used by the present function.
This function computes the standard-errors of the estimated parameters using a normal approximations of the maximum likelihood estimates: this is likely to be inaccurate because of asymmetries of the likelihood function (Nee et al. 1995). In addition, 95% confidence intervals of both parameters are computed using profile likelihood: they are particularly useful if the estimate of d/b is at the boundary of the parameter space (i.e. 0, which is often the case).
Note that the function does not check that the tree is effectively ultrametric, so if it is not, the returned result may not be meaningful.
An object of class "birthdeath" which is a list with the
following components:
tree |
the name of the tree analysed. |
N |
the number of species. |
dev |
the deviance (= -2 log lik) at its minimum. |
para |
the estimated parameters. |
se |
the corresponding standard-errors. |
CI |
the 95% profile-likelihood confidence intervals. |
Emmanuel Paradis
Kendall, D. G. (1948) On the generalized “birth-and-death” process. Annals of Mathematical Statistics, 19, 1–15.
Nee, S., May, R. M. and Harvey, P. H. (1994) The reconstructed evolutionary process. Philosophical Transactions of the Royal Society of London. Series B. Biological Sciences, 344, 305–311.
Nee, S., Holmes, E. C., May, R. M. and Harvey, P. H. (1995) Estimating extinctions from molecular phylogenies. in Extinction Rates, eds. Lawton, J. H. and May, R. M., pp. 164–182, Oxford University Press.
branching.times, diversi.gof,
diversi.time, ltt.plot,
yule, bd.ext, yule.cov,
bd.time
These functions analyse bipartitions found in a series of trees.
prop.part counts the number of bipartitions found in a series
of trees given as .... If a single tree is passed, the
returned object is a list of vectors with the tips descending from
each node (i.e., clade compositions indexed by node number).
prop.clades counts the number of times the bipartitions present
in phy are present in a series of trees given as ... or
in the list previously computed and given with part.
boot.phylo performs a bootstrap analysis.
boot.phylo(phy, x, FUN, B = 100, block = 1, trees = FALSE, quiet = FALSE, rooted = is.rooted(phy), jumble = TRUE, mc.cores = 1) prop.part(..., check.labels = TRUE) prop.clades(phy, ..., part = NULL, rooted = FALSE) ## S3 method for class 'prop.part' print(x, ...) ## S3 method for class 'prop.part' summary(object, ...) ## S3 method for class 'prop.part' plot(x, barcol = "blue", leftmar = 4, col = "red", ...)boot.phylo(phy, x, FUN, B = 100, block = 1, trees = FALSE, quiet = FALSE, rooted = is.rooted(phy), jumble = TRUE, mc.cores = 1) prop.part(..., check.labels = TRUE) prop.clades(phy, ..., part = NULL, rooted = FALSE) ## S3 method for class 'prop.part' print(x, ...) ## S3 method for class 'prop.part' summary(object, ...) ## S3 method for class 'prop.part' plot(x, barcol = "blue", leftmar = 4, col = "red", ...)
phy |
an object of class |
x |
in the case of |
FUN |
the function used to estimate |
B |
the number of bootstrap replicates. |
block |
the number of columns in |
trees |
a logical specifying whether to return the bootstraped
trees ( |
quiet |
a logical: a progress bar is displayed by default. |
rooted |
a logical specifying whether the trees should be treated as rooted or not. |
jumble |
a logical value. By default, the rows of |
mc.cores |
the number of cores (CPUs) to be used (passed to parallel). |
... |
either (i) a single object of class |
check.labels |
a logical specifying whether to check the labels
of each tree. If |
part |
a list of partitions as returned by |
object |
an object of class |
barcol |
the colour used for the bars displaying the number of partitions in the upper panel. |
leftmar |
the size of the margin on the left to display the tip labels. |
col |
the colour used to visualise the bipartitions. |
The argument FUN in boot.phylo must be the function used
to estimate the tree from the original data matrix. Thus, if the tree
was estimated with neighbor-joining (see nj), one maybe wants
something like FUN = function(xx) nj(dist.dna(xx)).
block in boot.phylo specifies the number of columns to
be resampled altogether. For instance, if one wants to resample at the
codon-level, then block = 3 must be used.
Using check.labels = FALSE in prop.part decreases
computing times. This requires that (i) all trees have the same tip
labels, and (ii) these labels are ordered similarly in all
trees (in other words, the element tip.label are identical in
all trees).
The plot function represents a contingency table of the different
partitions (on the x-axis) in the lower panel, and their observed
numbers in the upper panel. Any further arguments (...) are used to
change the aspects of the points in the lower panel: these may be
pch, col, bg, cex, etc. This function
works only if there is an attribute labels in the object.
The print method displays the partitions and their numbers. The summary method extracts the numbers only.
prop.part returns an object of class "prop.part" which
is a list with an attribute "number". The elements of this list
are the observed clades, and the attribute their respective
numbers. If the default check.labels = FALSE is used, an
attribute "labels" is added, and the vectors of the returned
object contains the indices of these labels instead of the labels
themselves.
prop.clades and boot.phylo return a numeric vector
which ith element is the number associated to the ith
node of phy. If trees = TRUE, boot.phylo returns
a list whose first element (named "BP") is like before, and the
second element ("trees") is a list with the bootstraped
trees.
summary returns a numeric vector.
prop.clades calls internally prop.part with the option
check.labels = TRUE, which may be very slow. If the trees
passed as ... fulfills conditions (i) and (ii) above, then it
might be faster to first call, e.g., pp <- prop.part(...), then
use the option part: prop.clades(phy, part = pp).
Since ape 3.5, prop.clades should return sensible results
for all values of rooted: if FALSE, the numbers of
bipartitions (or splits); if TRUE, the number of clades (of
hopefully rooted trees).
Emmanuel Paradis
Efron, B., Halloran, E. and Holmes, S. (1996) Bootstrap confidence levels for phylogenetic trees. Proceedings of the National Academy of Sciences USA, 93, 13429–13434.
Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution, 39, 783–791.
as.bitsplits, dist.topo,
consensus, nodelabels
data(woodmouse) f <- function(x) nj(dist.dna(x)) tr <- f(woodmouse) ### Are bootstrap values stable? for (i in 1:5) print(boot.phylo(tr, woodmouse, f, quiet = TRUE)) ### How many partitions in 100 random trees of 10 labels?... TR <- rmtree(100, 10) pp10 <- prop.part(TR) length(pp10) ### ... and in 100 random trees of 20 labels? TR <- rmtree(100, 20) pp20 <- prop.part(TR) length(pp20) plot(pp10, pch = "x", col = 2) plot(pp20, pch = "x", col = 2) set.seed(2) tr <- rtree(10) # rooted ## the following used to return a wrong result with ape <= 3.4: prop.clades(tr, tr) prop.clades(tr, tr, rooted = TRUE) tr <- rtree(10, rooted = FALSE) prop.clades(tr, tr) # correct ### an illustration of the use of prop.clades with bootstrap trees: fun <- function(x) as.phylo(hclust(dist.dna(x), "average")) # upgma() in phangorn tree <- fun(woodmouse) ## get 100 bootstrap trees: bstrees <- boot.phylo(tree, woodmouse, fun, trees = TRUE)$trees ## get proportions of each clade: clad <- prop.clades(tree, bstrees, rooted = TRUE) ## get proportions of each bipartition: boot <- prop.clades(tree, bstrees) layout(1) par(mar = rep(2, 4)) plot(tree, main = "Bipartition vs. Clade Support Values") drawSupportOnEdges(boot) nodelabels(clad) legend("bottomleft", legend = c("Bipartitions", "Clades"), pch = 22, pt.bg = c("green", "lightblue"), pt.cex = 2.5) ## Not run: ## an example of double bootstrap: nrep1 <- 100 nrep2 <- 100 p <- ncol(woodmouse) DB <- 0 for (b in 1:nrep1) { X <- woodmouse[, sample(p, p, TRUE)] DB <- DB + boot.phylo(tr, X, f, nrep2, quiet = TRUE) } DB ## to compare with: boot.phylo(tr, woodmouse, f, 1e4) ## End(Not run)data(woodmouse) f <- function(x) nj(dist.dna(x)) tr <- f(woodmouse) ### Are bootstrap values stable? for (i in 1:5) print(boot.phylo(tr, woodmouse, f, quiet = TRUE)) ### How many partitions in 100 random trees of 10 labels?... TR <- rmtree(100, 10) pp10 <- prop.part(TR) length(pp10) ### ... and in 100 random trees of 20 labels? TR <- rmtree(100, 20) pp20 <- prop.part(TR) length(pp20) plot(pp10, pch = "x", col = 2) plot(pp20, pch = "x", col = 2) set.seed(2) tr <- rtree(10) # rooted ## the following used to return a wrong result with ape <= 3.4: prop.clades(tr, tr) prop.clades(tr, tr, rooted = TRUE) tr <- rtree(10, rooted = FALSE) prop.clades(tr, tr) # correct ### an illustration of the use of prop.clades with bootstrap trees: fun <- function(x) as.phylo(hclust(dist.dna(x), "average")) # upgma() in phangorn tree <- fun(woodmouse) ## get 100 bootstrap trees: bstrees <- boot.phylo(tree, woodmouse, fun, trees = TRUE)$trees ## get proportions of each clade: clad <- prop.clades(tree, bstrees, rooted = TRUE) ## get proportions of each bipartition: boot <- prop.clades(tree, bstrees) layout(1) par(mar = rep(2, 4)) plot(tree, main = "Bipartition vs. Clade Support Values") drawSupportOnEdges(boot) nodelabels(clad) legend("bottomleft", legend = c("Bipartitions", "Clades"), pch = 22, pt.bg = c("green", "lightblue"), pt.cex = 2.5) ## Not run: ## an example of double bootstrap: nrep1 <- 100 nrep2 <- 100 p <- ncol(woodmouse) DB <- 0 for (b in 1:nrep1) { X <- woodmouse[, sample(p, p, TRUE)] DB <- DB + boot.phylo(tr, X, f, nrep2, quiet = TRUE) } DB ## to compare with: boot.phylo(tr, woodmouse, f, 1e4) ## End(Not run)
This function computes the branching times of a phylogenetic tree, that is the distance from each node to the tips, under the assumption that the tree is ultrametric. Note that the function does not check that the tree is effectively ultrametric, so if it is not, the returned result may not be meaningful.
branching.times(phy)branching.times(phy)
phy |
an object of class |
a numeric vector with the branching times. If the phylogeny phy
has an element node.label, this is used as names for the
returned vector; otherwise the numbers (of mode character) of the
matrix edge of phy are used as names.
Emmanuel Paradis
These functions help to build lists of trees of class "multiPhylo".
## S3 method for class 'phylo' c(..., recursive = TRUE) ## S3 method for class 'multiPhylo' c(..., recursive = TRUE) .compressTipLabel(x, ref = NULL) .uncompressTipLabel(x)## S3 method for class 'phylo' c(..., recursive = TRUE) ## S3 method for class 'multiPhylo' c(..., recursive = TRUE) .compressTipLabel(x, ref = NULL) .uncompressTipLabel(x)
... |
one or several objects of class |
recursive |
see details. |
x |
an object of class |
ref |
an optional vector of mode character to constrain the order of the tips. By default, the order from the first tree is used. |
These c methods check all the arguments, and return by default
a list of single trees unless some objects are not trees or lists of
trees, in which case recursive is switched to FALSE and a
warning message is given. If recursive = FALSE, the objects are
simply concatenated into a list. Before ape 4.0, recursive
was always set to FALSE.
.compressTipLabel transforms an object of class
"multiPhylo" by checking that all trees have the same tip
labels and renumbering the tips in the edge matrix so that the
tip numbers are also the same taking the first tree as the reference
(duplicated labels are not allowed). The returned object has a unique
vector of tip labels (attr(x, "TipLabel")).
.uncompressTipLabel does the reverse operation.
An object of class "multiPhylo".
Emmanuel Paradis
x <- c(rtree(4), rtree(2)) x y <- c(rtree(4), rtree(4)) z <- c(x, y) z print(z, TRUE) try(.compressTipLabel(x)) # error a <- .compressTipLabel(y) .uncompressTipLabel(a) # back to y ## eventually compare str(a) and str(y)x <- c(rtree(4), rtree(2)) x y <- c(rtree(4), rtree(4)) z <- c(x, y) z print(z, TRUE) try(.compressTipLabel(x)) # error a <- .compressTipLabel(y) .uncompressTipLabel(a) # back to y ## eventually compare str(a) and str(y)
Function CADM.global compute and test the coefficient of concordance among several distance matrices through a permutation test.
Function CADM.post carries out a posteriori permutation tests of the contributions of individual distance matrices to the overall concordance of the group.
Use in phylogenetic analysis: to identify congruence among distance matrices (D) representing different genes or different types of data. Congruent D matrices correspond to data tables that can be used together in a combined phylogenetic or other type of multivariate analysis.
CADM.global(Dmat, nmat, n, nperm=99, make.sym=TRUE, weights=NULL, silent=FALSE) CADM.post (Dmat, nmat, n, nperm=99, make.sym=TRUE, weights=NULL, mult="holm", mantel=FALSE, silent=FALSE)CADM.global(Dmat, nmat, n, nperm=99, make.sym=TRUE, weights=NULL, silent=FALSE) CADM.post (Dmat, nmat, n, nperm=99, make.sym=TRUE, weights=NULL, mult="holm", mantel=FALSE, silent=FALSE)
Dmat |
A text file listing the distance matrices one after the other, with or without blank lines in-between. Each matrix is in the form of a square distance matrix with 0's on the diagonal. |
nmat |
Number of distance matrices in file Dmat. |
n |
Number of objects in each distance matrix. All matrices must have the same number of objects. |
nperm |
Number of permutations for the tests of significance. |
make.sym |
TRUE: turn asymmetric matrices into symmetric matrices by averaging the two triangular portions. FALSE: analyse asymmetric matrices as they are. |
weights |
A vector of positive weights for the distance matrices. Example: weights = c(1,2,3). NULL (default): all matrices have same weight in the calculation of W. |
mult |
Method for correcting P-values in multiple testing. The methods are "holm" (default), "sidak", and "bonferroni". The Bonferroni correction is overly conservative; it is not recommended. It is included to allow comparisons with the other methods. |
mantel |
TRUE: Mantel statistics will be computed from ranked distances, as well as permutational P-values. FALSE (default): Mantel statistics and tests will not be computed. |
silent |
TRUE: informative messages will not be printed, but stopping messages will. Option useful for simulation work. FALSE: informative messages will be printed. |
Dmat must contain two or more distance matrices, listed one after the other, all of the same size, and corresponding to the same objects in the same order. Raw data tables can be transformed into distance matrices before comparison with other such distance matrices, or with data that have been obtained as distance matrices, e.g. serological or DNA hybridization data. The distances will be transformed to ranks before computation of the coefficient of concordance and other statistics.
CADM.global tests the global null hypothesis that all matrices are incongruent. If the global null is rejected, function CADM.post can be used to identify the concordant (H0 rejected) and discordant matrices (H0 not rejected) in the group. If a distance matrix has a negative value for the Mantel.mean statistic, that matrix clearly does not belong to the group. Remove that matrix (if there are more than one, remove first the matrix that has the most strongly negative value for Mantel.mean) and run the analysis again.
The corrections used for multiple testing are applied to the list of P-values (P) produced in the a posteriori tests; they take into account the number of tests (k) carried out simulatenously (number of matrices, parameter nmat).
The Holm correction is computed after ordering the P-values in a list with the smallest value to the left. Compute adjusted P-values as:
where i is the position in the ordered list. Final step: from left to right, if an adjusted in the ordered list is smaller than the one occurring at its left, make the smallest one equal to the largest one.
The Sidak correction is:
The Bonferonni correction is:
CADM.global produces a small table containing the W, Chi2, and Prob.perm statistics described in the following list.
CADM.post produces a table stored in element A_posteriori_tests, containing Mantel.mean, Prob, and Corrected.prob statistics in rows; the columns correspond to the k distance matrices under study, labeled Dmat.1 to Dmat.k.
If parameter mantel is TRUE, tables of Mantel statistics and P-values are computed among the matrices.
W |
Kendall's coefficient of concordance, W (Kendall and Babington Smith 1939; see also Legendre 2010). |
Chi2 |
Friedman's chi-square statistic (Friedman 1937) used in the permutation test of W. |
Prob.perm |
Permutational probability. |
Mantel.mean |
Mean of the Mantel correlations, computed on rank-transformed distances, between the distance matrix under test and all the other matrices in the study. |
Prob |
Permutational probabilities, uncorrected. |
Corrected prob |
Permutational probabilities corrected using the method selected in parameter |
Mantel.cor |
Matrix of Mantel correlations, computed on rank-transformed distances, among the distance matrices. |
Mantel.prob |
One-tailed P-values associated with the Mantel correlations of the previous table. The probabilities are computed in the right-hand tail. H0 is tested against the alternative one-tailed hypothesis that the Mantel correlation under test is positive. No correction is made for multiple testing. |
Pierre Legendre, Universite de Montreal
Campbell, V., Legendre, P. and Lapointe, F.-J. (2009) Assessing congruence among ultrametric distance matrices. Journal of Classification, 26, 103–117.
Campbell, V., Legendre, P. and Lapointe, F.-J. (2011) The performance of the Congruence Among Distance Matrices (CADM) test in phylogenetic analysis. BMC Evolutionary Biology, 11, 64.
Friedman, M. (1937) The use of ranks to avoid the assumption of normality implicit in the analysis of variance. Journal of the American Statistical Association, 32, 675–701.
Kendall, M. G. and Babington Smith, B. (1939) The problem of m rankings. Annals of Mathematical Statistics, 10, 275–287.
Lapointe, F.-J., Kirsch, J. A. W. and Hutcheon, J. M. (1999) Total evidence, consensus, and bat phylogeny: a distance-based approach. Molecular Phylogenetics and Evolution, 11, 55–66.
Legendre, P. (2010) Coefficient of concordance. Pp. 164-169 in: Encyclopedia of Research Design, Vol. 1. N. J. Salkind, ed. SAGE Publications, Inc., Los Angeles.
Legendre, P. and Lapointe, F.-J. (2004) Assessing congruence among distance matrices: single malt Scotch whiskies revisited. Australian and New Zealand Journal of Statistics, 46, 615–629.
Legendre, P. and Lapointe, F.-J. (2005) Congruence entre matrices de distance. P. 178-181 in: Makarenkov, V., G. Cucumel et F.-J. Lapointe [eds] Comptes rendus des 12emes Rencontres de la Societe Francophone de Classification, Montreal, 30 mai - 1er juin 2005.
Siegel, S. and Castellan, N. J., Jr. (1988) Nonparametric statistics for the behavioral sciences. 2nd edition. New York: McGraw-Hill.
# Examples 1 and 2: 5 genetic distance matrices computed from simulated DNA # sequences representing 50 taxa having evolved along additive trees with # identical evolutionary parameters (GTR+ Gamma + I). Distance matrices were # computed from the DNA sequence matrices using a p distance corrected with the # same parameters as those used to simulate the DNA sequences. See Campbell et # al. (2009) for details. # Example 1: five independent additive trees. Data provided by V. Campbell. data(mat5Mrand) res.global <- CADM.global(mat5Mrand, 5, 50) # Example 2: three partly similar trees, two independent trees. # Data provided by V. Campbell. data(mat5M3ID) res.global <- CADM.global(mat5M3ID, 5, 50) res.post <- CADM.post(mat5M3ID, 5, 50, mantel=TRUE) # Example 3: three matrices respectively representing Serological # (asymmetric), DNA hybridization (asymmetric) and Anatomical (symmetric) # distances among 9 families. Data from Lapointe et al. (1999). data(mat3) res.global <- CADM.global(mat3, 3, 9, nperm=999) res.post <- CADM.post(mat3, 3, 9, nperm=999, mantel=TRUE) # Example 4, showing how to bind two D matrices (cophenetic matrices # in this example) into a file using rbind(), then run the global test. a <- rtree(5) b <- rtree(5) A <- cophenetic(a) B <- cophenetic(b) x <- rownames(A) B <- B[x, x] M <- rbind(A, B) CADM.global(M, 2, 5)# Examples 1 and 2: 5 genetic distance matrices computed from simulated DNA # sequences representing 50 taxa having evolved along additive trees with # identical evolutionary parameters (GTR+ Gamma + I). Distance matrices were # computed from the DNA sequence matrices using a p distance corrected with the # same parameters as those used to simulate the DNA sequences. See Campbell et # al. (2009) for details. # Example 1: five independent additive trees. Data provided by V. Campbell. data(mat5Mrand) res.global <- CADM.global(mat5Mrand, 5, 50) # Example 2: three partly similar trees, two independent trees. # Data provided by V. Campbell. data(mat5M3ID) res.global <- CADM.global(mat5M3ID, 5, 50) res.post <- CADM.post(mat5M3ID, 5, 50, mantel=TRUE) # Example 3: three matrices respectively representing Serological # (asymmetric), DNA hybridization (asymmetric) and Anatomical (symmetric) # distances among 9 families. Data from Lapointe et al. (1999). data(mat3) res.global <- CADM.global(mat3, 3, 9, nperm=999) res.post <- CADM.post(mat3, 3, 9, nperm=999, mantel=TRUE) # Example 4, showing how to bind two D matrices (cophenetic matrices # in this example) into a file using rbind(), then run the global test. a <- rtree(5) b <- rtree(5) A <- cophenetic(a) B <- cophenetic(b) x <- rownames(A) B <- B[x, x] M <- rbind(A, B) CADM.global(M, 2, 5)
Dataset adapted from Gittleman (1986), including 2 morphological variables (body and brain sizes), 8 life history traits variables and 4 taxonomic variables.
data(carnivora)data(carnivora)
A data frame with 112 observations on 17 variables.
| [,1] | Order | factor | Carnivora order |
| [,2] | SuperFamily | factor | Super family (Caniformia or Feliformia) |
| [,3] | Family | factor | Carnivora family |
| [,4] | Genus | factor | Carnivora genus |
| [,5] | Species | factor | Carnivora species |
| [,6] | FW | numeric | Female body weight (kg) |
| [,7] | SW | numeric | Average body weight of adult male and adult female (kg) |
| [,8] | FB | numeric | Female brain weight (g) |
| [,9] | SB | numeric | Average brain weight of adult male and adult female (g) |
| [,10] | LS | numeric | Litter size |
| [,11] | GL | numeric | Gestation length (days) |
| [,12] | BW | numeric | Birth weigth (g) |
| [,13] | WA | numeric | Weaning age (days) |
| [,14] | AI | numeric | Age of independance (days) |
| [,15] | LY | numeric | Longevity (months) |
| [,16] | AM | numeric | Age of sexual maturity (days) |
| [,17] | IB | numeric | Inter-birth interval (months) |
Gittleman, J. L. (1986) Carnivore life history patterns: allometric, phylogenetic and ecological associations. American Naturalist, 127: 744–771.
data(carnivora) ## Fig. 1 in Gittleman (1986): plot(carnivora$BW ~ carnivora$FW, pch = (1:8)[carnivora$Family], log = "xy", xlab = "Female body weight (kg)", ylab = "Birth weigth (g)", ylim = c(1, 2000)) legend("bottomright", legend = levels(carnivora$Family), pch = 1:8) plot(carnivora$BW ~ carnivora$FB, pch = (1:8)[carnivora$Family], log = "xy", xlab = "Female brain weight (g)", ylab = "Birth weigth (g)", ylim = c(1, 2000)) legend("bottomright", legend = levels(carnivora$Family), pch = 1:8)data(carnivora) ## Fig. 1 in Gittleman (1986): plot(carnivora$BW ~ carnivora$FW, pch = (1:8)[carnivora$Family], log = "xy", xlab = "Female body weight (kg)", ylab = "Birth weigth (g)", ylim = c(1, 2000)) legend("bottomright", legend = levels(carnivora$Family), pch = 1:8) plot(carnivora$BW ~ carnivora$FB, pch = (1:8)[carnivora$Family], log = "xy", xlab = "Female brain weight (g)", ylab = "Birth weigth (g)", ylim = c(1, 2000)) legend("bottomright", legend = levels(carnivora$Family), pch = 1:8)
This function performs a series of diagnostics on a DNA sequence alignement.
checkAlignment(x, check.gaps = TRUE, plot = TRUE, what = 1:4)checkAlignment(x, check.gaps = TRUE, plot = TRUE, what = 1:4)
x |
an object of class |
check.gaps |
a logical value specifying whether to check the distribution of alignment gaps. |
plot |
a logical value specifying whether to do the plots. |
what |
an integer value giving the plot to be done. By default, four plots are done on the same figure. |
This function prints on the console a series of diagnostics on the set a aligned DNA sequences. If alignment gaps are present, their width distribution is analysed, as well as the width of contiguous base segments. The pattern of nucleotide diversity on each site is also analysed, and a relevant table is printed.
If plot = TRUE, four plots are done: an image of the
alignement, the distribution of gap widths (if present), the Shannon
index of nucleotide diversity along the sequence, and the number of
observed bases along the sequence.
If the sequences contain many gaps, it might be better to set
check.gaps = FALSE to skip the analysis of contiguous
segments.
NULL
Emmanuel Paradis
alview, image.DNAbin, all.equal.DNAbin
data(woodmouse) checkAlignment(woodmouse) layout(1)data(woodmouse) checkAlignment(woodmouse) layout(1)
Checking and correcting character strings, particularly before writing a Newick tree.
checkLabel(x)checkLabel(x)
x |
a vector of mode character. |
This function deletes the leading and trailing spaces (including tabulations, new lines, and left or right parentheses at the beginning or end of the strings), substitutes the spaces inside the strings by underscores, and substitutes commas, colons, semicolons, and parentheses inside the strings by dashes.
a vector of mode character.
Emmanuel Paradis
makeLabel, makeNodeLabel,
mixedFontLabel, stripLabel,
updateLabel
checkLabel(" Homo sapiens\t(Primates; World) ")checkLabel(" Homo sapiens\t(Primates; World) ")
This function takes as single argument an object (phy), checks its elements, and prints a diagnostic. All problems are printed with a label: FATAL (will likely cause an error or a crash) or MODERATE (may cause some problems).
This function is mainly intended for developers creating
"phylo" objects from scratch.
checkValidPhylo(phy)checkValidPhylo(phy)
phy |
an object of class |
NULL.
Emmanuel Paradis
tr <- rtree(3) checkValidPhylo(tr) tr$edge[1] <- 0 checkValidPhylo(tr)tr <- rtree(3) checkValidPhylo(tr) tr$edge[1] <- 0 checkValidPhylo(tr)
This function calculates the number of cherries (see definition below) on a phylogenetic tree, and tests the null hypotheses whether this number agrees with those predicted from two null models of trees (the Yule model, and the uniform model).
cherry(phy)cherry(phy)
phy |
an object of class |
A cherry is a pair of adjacent tips on a tree. The tree can be either rooted or unrooted, but the present function considers only rooted trees. The probability distribution function of the number of cherries on a tree depends on the speciation/extinction model that generated the tree.
McKenzie and Steel (2000) derived the probability distribution function of the number of cherries for two models: the Yule model and the uniform model. Broadly, in the Yule model, each extant species is equally likely to split into two daughter-species; in the uniform model, a branch is added to tree on any of the already existing branches with a uniform probability.
The probabilities are computed using recursive formulae; however, for both models, the probability density function converges to a normal law with increasing number of tips in the tree. The function uses these normal approximations for a number of tips greater than or equal to 20.
A NULL value is returned, the results are simply printed.
Emmanuel Paradis
McKenzie, A. and Steel, M. (2000) Distributions of cherries for two models of trees. Mathematical Biosciences, 164, 81–92.
This phylogeny of bats (Mammalia: Chiroptera) is a supertree (i.e., a composite phylogeny constructed from several sources; see source for details).
data(chiroptera)data(chiroptera)
Jones, K. E., Purvis, A., MacLarnon, A., Bininda-Emonds, O. R. P. and Simmons, N. B. (2002) A phylogenetic supertree of the bats (Mammalia: Chiroptera). Biological Reviews of the Cambridge Philosophical Society, 77, 223–259.
data(chiroptera) str(chiroptera) op <- par(cex = 0.3) plot(chiroptera, type = "c") par(op)data(chiroptera) str(chiroptera) op <- par(cex = 0.3) plot(chiroptera, type = "c") par(op)
This function estimates the node ages of a tree using the mean path lengths method of Britton et al. (2002). The branch lengths of the input tree are interpreted as (mean) numbers of substitutions.
chronoMPL(phy, se = TRUE, test = TRUE)chronoMPL(phy, se = TRUE, test = TRUE)
phy |
an object of class |
se |
a logical specifying whether to compute the standard-errors
of the node ages ( |
test |
a logical specifying whether to test the molecular clock
at each node ( |
The mean path lengths (MPL) method estimates the age of a node with the mean of the distances from this node to all tips descending from it. Under the assumption of a molecular clock, standard-errors of the estimates node ages can be computed (Britton et al. 2002).
The tests performed if test = TRUE is a comparison of the MPL
of the two subtrees originating from a node; the null hypothesis is
that the rate of substitution was the same in both subtrees (Britton
et al. 2002). The test statistic follows, under the null hypothesis, a
standard normal distribution. The returned P-value is the
probability of observing a greater absolute value (i.e., a two-sided
test). No correction for multiple testing is applied: this is left to
the user.
Absolute dating can be done by multiplying the edge lengths found by calibrating one node age.
an object of class "phylo" with branch lengths as estimated by
the function. There are, by default, two attributes:
stderr |
the standard-errors of the node ages. |
Pval |
the P-value of the test of the molecular clock for each node. |
Emmanuel Paradis
Britton, T., Oxelman, B., Vinnersten, A. and Bremer, K. (2002) Phylogenetic dating with confidence intervals using mean path lengths. Molecular Phylogenetics and Evolution, 24, 58–65.
tr <- rtree(10) tr$edge.length <- 5*tr$edge.length chr <- chronoMPL(tr) layout(matrix(1:4, 2, 2, byrow = TRUE)) plot(tr) title("The original tree") plot(chr) axisPhylo() title("The dated MPL tree") plot(chr) nodelabels(round(attr(chr, "stderr"), 3)) title("The standard-errors") plot(tr) nodelabels(round(attr(chr, "Pval"), 3)) title("The tests") layout(1)tr <- rtree(10) tr$edge.length <- 5*tr$edge.length chr <- chronoMPL(tr) layout(matrix(1:4, 2, 2, byrow = TRUE)) plot(tr) title("The original tree") plot(chr) axisPhylo() title("The dated MPL tree") plot(chr) nodelabels(round(attr(chr, "stderr"), 3)) title("The standard-errors") plot(tr) nodelabels(round(attr(chr, "Pval"), 3)) title("The tests") layout(1)
This function estimates the node ages of a tree using a semi-parametric method based on penalized likelihood (Sanderson 2002). The branch lengths of the input tree are interpreted as mean numbers of substitutions (i.e., per site).
chronopl(phy, lambda, age.min = 1, age.max = NULL, node = "root", S = 1, tol = 1e-8, CV = FALSE, eval.max = 500, iter.max = 500, ...)chronopl(phy, lambda, age.min = 1, age.max = NULL, node = "root", S = 1, tol = 1e-8, CV = FALSE, eval.max = 500, iter.max = 500, ...)
phy |
an object of class |
lambda |
value of the smoothing parameter. |
age.min |
numeric values specifying the fixed node ages (if
|
age.max |
numeric values specifying the oldest bound of the nodes known to be within an interval. |
node |
the numbers of the nodes whose ages are given by
|
S |
the number of sites in the sequences; leave the default if branch lengths are in mean number of substitutions. |
tol |
the value below which branch lengths are considered effectively zero. |
CV |
whether to perform cross-validation. |
eval.max |
the maximal number of evaluations of the penalized likelihood function. |
iter.max |
the maximal number of iterations of the optimization algorithm. |
... |
further arguments passed to control |
The idea of this method is to use a trade-off between a parametric formulation where each branch has its own rate, and a nonparametric term where changes in rates are minimized between contiguous branches. A smoothing parameter (lambda) controls this trade-off. If lambda = 0, then the parametric component dominates and rates vary as much as possible among branches, whereas for increasing values of lambda, the variation are smoother to tend to a clock-like model (same rate for all branches).
lambda must be given. The known ages are given in
age.min, and the correponding node numbers in node.
These two arguments must obviously be of the same length. By default,
an age of 1 is assumed for the root, and the ages of the other nodes
are estimated.
If age.max = NULL (the default), it is assumed that
age.min gives exactly known ages. Otherwise, age.max and
age.min must be of the same length and give the intervals for
each node. Some node may be known exactly while the others are
known within some bounds: the values will be identical in both
arguments for the former (e.g., age.min = c(10, 5), age.max =
c(10, 6), node = c(15, 18) means that the age of node 15 is 10
units of time, and the age of node 18 is between 5 and 6).
If two nodes are linked (i.e., one is the ancestor of the other) and
have the same values of age.min and age.max (say, 10 and
15) this will result in an error because the medians of these values
are used as initial times (here 12.5) giving initial branch length(s)
equal to zero. The easiest way to solve this is to change slightly the
given values, for instance use age.max = 14.9 for the youngest
node, or age.max = 15.1 for the oldest one (or similarly for
age.min).
The input tree may have multichotomies. If some internal branches are of zero-length, they are collapsed (with a warning), and the returned tree will have less nodes than the input one. The presence of zero-lengthed terminal branches of results in an error since it makes little sense to have zero-rate branches.
The cross-validation used here is different from the one proposed by
Sanderson (2002). Here, each tip is dropped successively and the
analysis is repeated with the reduced tree: the estimated dates for
the remaining nodes are compared with the estimates from the full
data. For the th tip the following is calculated:
,
where is the estimated date for the th node
with the full phylogeny, is the estimated date
for the th node after removing tip from the tree,
and is the number of tips.
The present version uses the nlminb to optimise
the penalized likelihood function: see its help page for details on
parameters controlling the optimisation procedure.
an object of class "phylo" with branch lengths as estimated by
the function. There are three or four further attributes:
ploglik |
the maximum penalized log-likelihood. |
rates |
the estimated rates for each branch. |
message |
the message returned by |
D2 |
the influence of each observation on overall date
estimates (if |
The new function chronos replaces the present one which
is no more maintained.
Emmanuel Paradis
Sanderson, M. J. (2002) Estimating absolute rates of molecular evolution and divergence times: a penalized likelihood approach. Molecular Biology and Evolution, 19, 101–109.
chronos is the main function fitting a chronogram to a
phylogenetic tree whose branch lengths are in number of substitution
per sites.
makeChronosCalib is a tool to prepare data frames with the
calibration points of the phylogenetic tree.
chronos.control creates a list of parameters to be passed
to chronos.
chronos(phy, lambda = 1, model = "correlated", quiet = FALSE, calibration = makeChronosCalib(phy), control = chronos.control()) ## S3 method for class 'chronos' print(x, ...) makeChronosCalib(phy, node = "root", age.min = 1, age.max = age.min, interactive = FALSE, soft.bounds = FALSE) chronos.control(...)chronos(phy, lambda = 1, model = "correlated", quiet = FALSE, calibration = makeChronosCalib(phy), control = chronos.control()) ## S3 method for class 'chronos' print(x, ...) makeChronosCalib(phy, node = "root", age.min = 1, age.max = age.min, interactive = FALSE, soft.bounds = FALSE) chronos.control(...)
phy |
an object of class |
lambda |
value of the smoothing parameter. |
model |
a character string specifying the model of substitution rate variation among branches. The possible choices are: “correlated”, “relaxed”, “discrete”, “clock”, or an unambiguous abbreviation of these. |
quiet |
a logical value; by default the calculation progress are displayed. |
calibration |
a data frame (see details). |
control |
a list of parameters controlling the optimisation procedure (see details). |
x |
an object of class |
node |
a vector of integers giving the node numbers for which a calibration point is given. The default is a short-cut for the root. |
age.min, age.max
|
vectors of numerical values giving the minimum
and maximum ages of the nodes specified in |
interactive |
a logical value. If |
soft.bounds |
(currently unused) |
... |
in the case of |
chronos replaces chronopl but with a different interface
and some extensions (see References).
The known dates (argument calibration) must be given in a data
frame with the following column names: node, age.min, age.max, and
soft.bounds (the last one is yet unused). For each row, these are,
respectively: the number of the node in the “phylo” coding standard,
the minimum age for this node, the maximum age, and a logical value
specifying whether the bounds are soft. If age.min = age.max, this
means that the age is exactly known. This data frame can be built with
makeChronosCalib which returns by default a data frame with a
single row giving age = 1 for the root. The data frame can be built
interactively by clicking on the plotted tree.
The argument control allows one to change some parameters of
the optimisation procedure. This must be a list with names. The
available options with their default values are:
tol = 1e-8: tolerance for the estimation of the substitution rates.
iter.max = 1e4: the maximum number of iterations at each optimization step.
eval.max = 1e4: the maximum number of function evaluations at each optimization step.
nb.rate.cat = 10: the number of rate categories if model
= "discrete" (set this parameter to 1 to fit a strict clock
model).
dual.iter.max = 20: the maximum number of alternative iterations between rates and dates.
epsilon = 1e-6: the convergence diagnostic criterion.
Using model = "clock" is actually a short-cut to model =
"discrete" and setting nb.rate.cat = 1 in the list passed to
control.
The command chronos.control() returns a list with the default
values of these parameters. They may be modified by passing them to
this function, or directly in the list.
chronos returns an object of class c("chronos",
"phylo"). There is a print method for it. There are additional
attributes which can be visualised with str or extracted with
attr.
makeChronosCalib returns a data frame.
chronos.control returns a list.
Emmanuel Paradis, Santiago Claramunt, Guillaume Louvel
Kim, J. and Sanderson, M. J. (2008) Penalized likelihood phylogenetic inference: bridging the parsimony-likelihood gap. Systematic Biology, 57, 665–674.
Paradis, E. (2013) Molecular dating of phylogenies by likelihood methods: a comparison of models and a new information criterion. Molecular Phylogenetics and Evolution, 67, 436–444.
Sanderson, M. J. (2002) Estimating absolute rates of molecular evolution and divergence times: a penalized likelihood approach. Molecular Biology and Evolution, 19, 101–109.
library(ape) tr <- rtree(10) ### the default is the correlated rate model: chr <- chronos(tr) ### strict clock model: ctrl <- chronos.control(nb.rate.cat = 1) chr.clock <- chronos(tr, model = "discrete", control = ctrl) ### How different are the rates? attr(chr, "rates") attr(chr.clock, "rates") ## Not run: cal <- makeChronosCalib(tr, interactive = TRUE) cal ### if you made mistakes, you can edit the data frame with: ### fix(cal) chr <- chronos(tr, calibration = cal) ## End(Not run)library(ape) tr <- rtree(10) ### the default is the correlated rate model: chr <- chronos(tr) ### strict clock model: ctrl <- chronos.control(nb.rate.cat = 1) chr.clock <- chronos(tr, model = "discrete", control = ctrl) ### How different are the rates? attr(chr, "rates") attr(chr.clock, "rates") ## Not run: cal <- makeChronosCalib(tr, interactive = TRUE) cal ### if you made mistakes, you can edit the data frame with: ### fix(cal) chr <- chronos(tr, calibration = cal) ## End(Not run)
These functions call their respective program from R to align a set
of nucleotide sequences of class "DNAbin" or
"AAbin". The application(s) must be installed seperately and it
is highly recommended to do this so that the executables are in a
directory located on the PATH of the system.
This version includes an experimental version of muscle5 which
calls MUSCLE5 (see the link to the documentation in the References
below); muscle still calls MUSCLE version 3. Note that the
executable of MUSCLE5 is also named ‘muscle’ by the default
compilation setting.
The functions efastats and letterconf require MUSCLE5.
clustal(x, y, guide.tree, pw.gapopen = 10, pw.gapext = 0.1, gapopen = 10, gapext = 0.2, exec = NULL, MoreArgs = "", quiet = TRUE, original.ordering = TRUE, file) clustalomega(x, y, guide.tree, exec = NULL,MoreArgs = "", quiet = TRUE, original.ordering = TRUE, file) mafft(x, y, exec = "mafft", MoreArgs = "", quiet = TRUE, original.ordering = TRUE) muscle(x, y, guide.tree, exec, MoreArgs = "", quiet = TRUE, original.ordering = TRUE, file) muscle5(x, exec = "muscle", MoreArgs = "", quiet = FALSE, file, super5 = FALSE, mc.cores = 1) tcoffee(x, exec = "t_coffee", MoreArgs = "", quiet = TRUE, original.ordering = TRUE) efastats(X, exec = "muscle", quiet = FALSE) letterconf(X, exec = "muscle")clustal(x, y, guide.tree, pw.gapopen = 10, pw.gapext = 0.1, gapopen = 10, gapext = 0.2, exec = NULL, MoreArgs = "", quiet = TRUE, original.ordering = TRUE, file) clustalomega(x, y, guide.tree, exec = NULL,MoreArgs = "", quiet = TRUE, original.ordering = TRUE, file) mafft(x, y, exec = "mafft", MoreArgs = "", quiet = TRUE, original.ordering = TRUE) muscle(x, y, guide.tree, exec, MoreArgs = "", quiet = TRUE, original.ordering = TRUE, file) muscle5(x, exec = "muscle", MoreArgs = "", quiet = FALSE, file, super5 = FALSE, mc.cores = 1) tcoffee(x, exec = "t_coffee", MoreArgs = "", quiet = TRUE, original.ordering = TRUE) efastats(X, exec = "muscle", quiet = FALSE) letterconf(X, exec = "muscle")
x |
an object of class |
y |
an object of class |
guide.tree |
guide tree, an object of class |
pw.gapopen, pw.gapext
|
gap opening and gap extension penalties used by Clustal during pairwise alignments. |
gapopen, gapext
|
idem for global alignment. |
exec |
a character string giving the name of the program, with
its path if necessary. |
MoreArgs |
a character string giving additional options. |
quiet |
a logical: the default is to not print on R's console the messages from the external program. |
original.ordering |
a logical specifying whether to return the
aligned sequences in the same order than in |
file |
a file with its path if results should be stored (can be missing). |
super5 |
a logical value. By default, the PPP algorithm is used. |
mc.cores |
the number of cores to be used by MUSCLE5. |
X |
a list with several alignments of the same sequences with all with the same row order. |
It is highly recommended to install the executables properly so that
they are in a directory located on the PATH (i.e., accessible from any
other directory). Alternatively, the full path to the executable
may be given (e.g., exec = "~/muscle/muscle"), or a (symbolic)
link may be copied in the working directory. For Debian and its
derivatives (e.g., Ubuntu), it is recommended to use the binaries
distributed by Debian.
clustal tries to guess the name of the executable program
depending on the operating system. Specifically, the followings are
used: “clustalw” under Linux, “clustalw2” under MacOS, and
“clustalw2.exe” under Windows. For clustalomega,
“clustalo[.exe]” is the default on all systems (with no specific
path).
When called without arguments (i.e., clustal(), ...), the
function prints the options of the program which may be passed to
MoreArgs.
Since ape 5.1, clustal, clustalomega, and
muscle can align AA sequences as well as DNA sequences.
an object of class "DNAbin" or "AAbin" with the aligned
sequences.
efastats returns a data frame.
letterconf opens the default Web brower.
Emmanuel Paradis, Franz Krah
Chenna, R., Sugawara, H., Koike, T., Lopez, R., Gibson, T. J., Higgins, D. G. and Thompson, J. D. (2003) Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Research 31, 3497–3500. http://www.clustal.org/
Edgar, R. C. (2004) MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research, 32, 1792–1797. http://www.drive5.com/muscle/muscle_userguide3.8.html
Katoh, K. and Standley, D. M. (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution, 30, 772–780. http://mafft.cbrc.jp/alignment/software/
Notredame, C., Higgins, D. and Heringa, J. (2000) T-Coffee: A novel method for multiple sequence alignments. Journal of Molecular Biology, 302, 205–217. https://tcoffee.org/
Sievers, F., Wilm, A., Dineen, D., Gibson, T. J., Karplus, K., Li, W., Lopez, R., McWilliam, H., Remmert, M., S\"oding, J., Thompson, J. D. and Higgins, D. G. (2011) Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Molecular Systems Biology, 7, 539. http://www.clustal.org/
image.DNAbin, del.gaps,
all.equal.DNAbin, alex,
alview, checkAlignment
## Not run: ### display the options: clustal() clustalomega() muscle() tcoffee() data(woodmouse) ### open gaps more easily: clustal(woodmouse, pw.gapopen = 1, pw.gapext = 1) ### T-Coffee requires negative values (quite slow; muscle() is much faster): tcoffee(woodmouse, MoreArgs = "-gapopen=-10 -gapext=-2") ## End(Not run)## Not run: ### display the options: clustal() clustalomega() muscle() tcoffee() data(woodmouse) ### open gaps more easily: clustal(woodmouse, pw.gapopen = 1, pw.gapext = 1) ### T-Coffee requires negative values (quite slow; muscle() is much faster): tcoffee(woodmouse, MoreArgs = "-gapopen=-10 -gapext=-2") ## End(Not run)
This function extracts or generates information about coalescent intervals (number of lineages, interval lengths, interval count, total depth) from a phylogenetic tree or a list of internode distances. The input tree needs to be ultra-metric (i.e. clock-like).
coalescent.intervals(x)coalescent.intervals(x)
x |
either an ultra-metric phylogenetic tree (i.e. an object of
class |
An object of class "coalescentIntervals" with the following entries:
lineages |
A vector with the number of lineages at the start of each coalescent interval. |
interval.length |
A vector with the length of each coalescent interval. |
interval.count |
The total number of coalescent intervals. |
total.depth |
The sum of the lengths of all coalescent intervals. |
Korbinian Strimmer
branching.times, collapsed.intervals,
read.tree.
data("hivtree.newick") # example tree in NH format tree.hiv <- read.tree(text = hivtree.newick) # load tree ci <- coalescent.intervals(tree.hiv) # from tree ci data("hivtree.table") # same tree, but in table format ci <- coalescent.intervals(hivtree.table$size) # from vector of interval lengths cidata("hivtree.newick") # example tree in NH format tree.hiv <- read.tree(text = hivtree.newick) # load tree ci <- coalescent.intervals(tree.hiv) # from tree ci data("hivtree.table") # same tree, but in table format ci <- coalescent.intervals(hivtree.table$size) # from vector of interval lengths ci
collapse.singles deletes the single nodes (i.e., with a single
descendant) in a tree or a list of trees. This is a generic function.
has.singles tests for the presence of single node(s) in a tree.
collapse.singles(tree, ...) ## S3 method for class 'phylo' collapse.singles(tree, root.edge = FALSE, ...) ## S3 method for class 'multiPhylo' collapse.singles(tree, root.edge = FALSE, ...) has.singles(tree)collapse.singles(tree, ...) ## S3 method for class 'phylo' collapse.singles(tree, root.edge = FALSE, ...) ## S3 method for class 'multiPhylo' collapse.singles(tree, root.edge = FALSE, ...) has.singles(tree)
tree |
an object of class |
root.edge |
whether to get the singleton edges from the root
until the first bifurcating node and put them as |
... |
argments passed to methods. |
an object of the same class than tree.
Emmanuel Paradis, Klaus Schliep
## a tree with 3 tips and 3 nodes: e <- c(4L, 6L, 6L, 5L, 5L, 6L, 1L, 5L, 3L, 2L) dim(e) <- c(5, 2) tr <- structure(list(edge = e, tip.label = LETTERS[1:3], Nnode = 3L), class = "phylo") tr has.singles(tr) ## the following shows that node #4 (ie, the root) is a singleton ## and node #6 is the first bifurcating node tr$edge ## A bifurcating tree has less nodes than it has tips: ## the following used to fail with ape 4.1 or lower: plot(tr) collapse.singles(tr) # only 2 nodes ## give branch lengths to use the 'root.edge' option: tr$edge.length <- runif(5) str(collapse.singles(tr, TRUE)) # has a 'root.edge'## a tree with 3 tips and 3 nodes: e <- c(4L, 6L, 6L, 5L, 5L, 6L, 1L, 5L, 3L, 2L) dim(e) <- c(5, 2) tr <- structure(list(edge = e, tip.label = LETTERS[1:3], Nnode = 3L), class = "phylo") tr has.singles(tr) ## the following shows that node #4 (ie, the root) is a singleton ## and node #6 is the first bifurcating node tr$edge ## A bifurcating tree has less nodes than it has tips: ## the following used to fail with ape 4.1 or lower: plot(tr) collapse.singles(tr) # only 2 nodes ## give branch lengths to use the 'root.edge' option: tr$edge.length <- runif(5) str(collapse.singles(tr, TRUE)) # has a 'root.edge'
This function takes a "coalescentIntervals" objects and collapses neighbouring
coalescent intervals into a single combined interval so that every collapsed interval is
larger than epsilon. Collapsed coalescent intervals are used, e.g., to obtain the
generalized skyline plot (skyline). For epsilon = 0 no interval
is collapsed.
collapsed.intervals(ci, epsilon=0)collapsed.intervals(ci, epsilon=0)
ci |
coalescent intervals (i.e. an object of class |
epsilon |
collapsing parameter that controls the amount of smoothing
(allowed range: from |
Proceeding from the tips to the root of the tree each small
interval is pooled with the neighboring interval closer to the root. If the
neighboring interval is also small, then pooling continues until the composite
interval is larger than epsilon. Note that this approach prevents the
occurrence of zero-length intervals at the present.
For more details see Strimmer and Pybus (2001).
An object of class "collapsedIntervals" with the following entries:
lineages |
A vector with the number of lineages at the start of each coalescent interval. |
interval.length |
A vector with the length of each coalescent interval. |
collapsed.interval |
A vector indicating for each coalescent interval to which collapsed interval it belongs. |
interval.count |
The total number of coalescent intervals. |
collapsed.interval.count |
The number of collapsed intervals. |
total.depth |
The sum of the lengths of all coalescent intervals. |
epsilon |
The value of the underlying smoothing parameter. |
Korbinian Strimmer
Strimmer, K. and Pybus, O. G. (2001) Exploring the demographic history of DNA sequences using the generalized skyline plot. Molecular Biology and Evolution, 18, 2298–2305.
data("hivtree.table") # example tree # colescent intervals from vector of interval lengths ci <- coalescent.intervals(hivtree.table$size) ci # collapsed intervals cl1 <- collapsed.intervals(ci,0) cl2 <- collapsed.intervals(ci,0.0119) cl1 cl2data("hivtree.table") # example tree # colescent intervals from vector of interval lengths ci <- coalescent.intervals(hivtree.table$size) ci # collapsed intervals cl1 <- collapsed.intervals(ci,0) cl2 <- collapsed.intervals(ci,0.0119) cl1 cl2
This function computes the phylogenetic variance component and the residual deviation for continous characters, taking into account the phylogenetic relationships among species, following the comparative method described in Cheverud et al. (1985). The correction proposed by Rholf (2001) is used.
compar.cheverud(y, W, tolerance = 1e-06, gold.tol = 1e-04)compar.cheverud(y, W, tolerance = 1e-06, gold.tol = 1e-04)
y |
A vector containing the data to analyse. |
W |
The phylogenetic connectivity matrix. All diagonal elements will be ignored. |
tolerance |
Minimum difference allowed to consider eigenvalues as distinct. |
gold.tol |
Precision to use in golden section search alogrithm. |
Model:
where is the error term, assumed to be normally distributed.
is estimated by the maximum likelihood procedure given
in Rohlf (2001), using a golden section search algorithm. The code of
this function is indeed adapted from a MatLab code given in appendix
in Rohlf's article, to correct a mistake in Cheverud's original paper.
A list with the following components:
rhohat |
The maximum likelihood estimate of |
Wnorm |
The normalized version of |
residuals |
Error terms ( |
Julien Dutheil [email protected]
Cheverud, J. M., Dow, M. M. and Leutenegger, W. (1985) The quantitative assessment of phylogenetic constraints in comparative analyses: sexual dimorphism in body weight among primates. Evolution, 39, 1335–1351.
Rohlf, F. J. (2001) Comparative methods for the analysis of continuous variables: geometric interpretations. Evolution, 55, 2143–2160.
Harvey, P. H. and Pagel, M. D. (1991) The Comparative Method in Evolutionary Biology. Oxford University Press.
### Example from Harvey and Pagel's book: y<-c(10,8,3,4) W <- matrix(c(1,1/6,1/6,1/6,1/6,1,1/2,1/2,1/6,1/2,1,1,1/6,1/2,1,1), 4) compar.cheverud(y,W) ### Example from Rohlf's 2001 article: W<- matrix(c( 0,1,1,2,0,0,0,0, 1,0,1,2,0,0,0,0, 1,1,0,2,0,0,0,0, 2,2,2,0,0,0,0,0, 0,0,0,0,0,1,1,2, 0,0,0,0,1,0,1,2, 0,0,0,0,1,1,0,2, 0,0,0,0,2,2,2,0 ),8) W <- 1/W W[W == Inf] <- 0 y<-c(-0.12,0.36,-0.1,0.04,-0.15,0.29,-0.11,-0.06) compar.cheverud(y,W)### Example from Harvey and Pagel's book: y<-c(10,8,3,4) W <- matrix(c(1,1/6,1/6,1/6,1/6,1,1/2,1/2,1/6,1/2,1,1,1/6,1/2,1,1), 4) compar.cheverud(y,W) ### Example from Rohlf's 2001 article: W<- matrix(c( 0,1,1,2,0,0,0,0, 1,0,1,2,0,0,0,0, 1,1,0,2,0,0,0,0, 2,2,2,0,0,0,0,0, 0,0,0,0,0,1,1,2, 0,0,0,0,1,0,1,2, 0,0,0,0,1,1,0,2, 0,0,0,0,2,2,2,0 ),8) W <- 1/W W[W == Inf] <- 0 y<-c(-0.12,0.36,-0.1,0.04,-0.15,0.29,-0.11,-0.06) compar.cheverud(y,W)
compar.gee performs the comparative analysis using generalized
estimating equations as described by Paradis and Claude (2002).
drop1 tests single effects of a fitted model output from
compar.gee.
predict returns the predicted (fitted) values of the model.
compar.gee(formula, data = NULL, family = "gaussian", phy, corStruct, scale.fix = FALSE, scale.value = 1) ## S3 method for class 'compar.gee' drop1(object, scope, quiet = FALSE, ...) ## S3 method for class 'compar.gee' predict(object, newdata = NULL, type = c("link", "response"), ...)compar.gee(formula, data = NULL, family = "gaussian", phy, corStruct, scale.fix = FALSE, scale.value = 1) ## S3 method for class 'compar.gee' drop1(object, scope, quiet = FALSE, ...) ## S3 method for class 'compar.gee' predict(object, newdata = NULL, type = c("link", "response"), ...)
formula |
a formula giving the model to be fitted. |
data |
the name of the data frame where the variables in
|
family |
a function specifying the distribution assumed for the
response; by default a Gaussian distribution (with link identity) is
assumed (see |
phy |
an object of class |
corStruct |
a (phylogenetic) correlation structure. |
scale.fix |
logical, indicates whether the scale parameter should be fixed (TRUE) or estimated (FALSE, the default). |
scale.value |
if |
object |
an object of class |
scope |
<unused>. |
quiet |
a logical specifying whether to display a warning message about eventual “marginality principle violation”. |
newdata |
a data frame with column names matching the variables
in the formula of the fitted object (see
|
type |
a character string specifying the type of predicted values. By default, the linear (link) prediction is returned. |
... |
further arguments to be passed to |
If a data frame is specified for the argument data, then its
rownames are matched to the tip labels of phy. The user must be
careful here since the function requires that both series of names
perfectly match, so this operation may fail if there is a typing or
syntax error. If both series of names do not match, the values in the
data frame are taken to be in the same order than the tip labels of
phy, and a warning message is issued.
If data = NULL, then it is assumed that the variables are in
the same order than the tip labels of phy.
compar.gee returns an object of class "compar.gee" with
the following components:
call |
the function call, including the formula. |
effect.assign |
a vector of integers assigning the coefficients
to the effects (used by |
nobs |
the number of observations. |
QIC |
the quasilikelihood information criterion as defined by Pan (2001). |
coefficients |
the estimated coefficients (or regression parameters). |
residuals |
the regression residuals. |
family |
a character string, the distribution assumed for the response. |
link |
a character string, the link function used for the mean function. |
scale |
the scale (or dispersion parameter). |
W |
the variance-covariance matrix of the estimated coefficients. |
dfP |
the phylogenetic degrees of freedom (see Paradis and Claude for details on this). |
drop1 returns an object of class "anova".
predict returns a vector or a data frame if newdata is used.
The calculation of the phylogenetic degrees of freedom is likely to be approximative for non-Brownian correlation structures (this will be refined soon).
The calculation of the quasilikelihood information criterion (QIC) needs to be tested.
Emmanuel Paradis
Pan, W. (2001) Akaike's information criterion in generalized estimating equations. Biometrics, 57, 120–125.
Paradis, E. and Claude J. (2002) Analysis of comparative data using generalized estimating equations. Journal of theoretical Biology, 218, 175–185.
read.tree, pic,
compar.lynch, drop1
### The example in Phylip 3.5c (originally from Lynch 1991) ### (the same analysis than in help(pic)...) tr <- "((((Homo:0.21,Pongo:0.21):0.28,Macaca:0.49):0.13,Ateles:0.62):0.38,Galago:1.00);" tree.primates <- read.tree(text = tr) X <- c(4.09434, 3.61092, 2.37024, 2.02815, -1.46968) Y <- c(4.74493, 3.33220, 3.36730, 2.89037, 2.30259) ### Both regressions... the results are quite close to those obtained ### with pic(). compar.gee(X ~ Y, phy = tree.primates) compar.gee(Y ~ X, phy = tree.primates) ### Now do the GEE regressions through the origin: the results are quite ### different! compar.gee(X ~ Y - 1, phy = tree.primates) compar.gee(Y ~ X - 1, phy = tree.primates)### The example in Phylip 3.5c (originally from Lynch 1991) ### (the same analysis than in help(pic)...) tr <- "((((Homo:0.21,Pongo:0.21):0.28,Macaca:0.49):0.13,Ateles:0.62):0.38,Galago:1.00);" tree.primates <- read.tree(text = tr) X <- c(4.09434, 3.61092, 2.37024, 2.02815, -1.46968) Y <- c(4.74493, 3.33220, 3.36730, 2.89037, 2.30259) ### Both regressions... the results are quite close to those obtained ### with pic(). compar.gee(X ~ Y, phy = tree.primates) compar.gee(Y ~ X, phy = tree.primates) ### Now do the GEE regressions through the origin: the results are quite ### different! compar.gee(X ~ Y - 1, phy = tree.primates) compar.gee(Y ~ X - 1, phy = tree.primates)
This function computes the heritable additive value and the residual deviation for continous characters, taking into account the phylogenetic relationships among species, following the comparative method described in Lynch (1991).
compar.lynch(x, G, eps = 1e-4)compar.lynch(x, G, eps = 1e-4)
x |
eiher a matrix, a vector, or a data.frame containing the data with species as rows and variables as columns. |
G |
a matrix that can be interpreted as an among-species correlation matrix. |
eps |
a numeric value to detect convergence of the EM algorithm. |
The parameter estimates are computed following the EM
(expectation-maximization) algorithm. This algorithm usually leads to
convergence but may lead to local optima of the likelihood
function. It is recommended to run several times the function in order
to detect these potential local optima. The ‘optimal’ value for
eps depends actually on the range of the data and may be
changed by the user in order to check the stability of the parameter
estimates. Convergence occurs when the differences between two
successive iterations of the EM algorithm leads to differences between
both residual and additive values less than or equal to eps.
A list with the following components:
vare |
estimated residual variance-covariance matrix. |
vara |
estimated additive effect variance covariance matrix. |
u |
estimates of the phylogeny-wide means. |
A |
addtitive value estimates. |
E |
residual values estimates. |
lik |
logarithm of the likelihood for the entire set of observed taxon-specific mean. |
This version does not perform the estimation of ancestral phentoypes as proposed by Lynch (1991).
Julien Claude
Lynch, M. (1991) Methods for the analysis of comparative data in evolutionary biology. Evolution, 45, 1065–1080.
### The example in Lynch (1991) x <- "((((Homo:0.21,Pongo:0.21):0.28,Macaca:0.49):0.13,Ateles:0.62):0.38,Galago:1.00);" tree.primates <- read.tree(text = x) X <- c(4.09434, 3.61092, 2.37024, 2.02815, -1.46968) Y <- c(4.74493, 3.33220, 3.36730, 2.89037, 2.30259) compar.lynch(cbind(X, Y), G = vcv.phylo(tree.primates, cor = TRUE))### The example in Lynch (1991) x <- "((((Homo:0.21,Pongo:0.21):0.28,Macaca:0.49):0.13,Ateles:0.62):0.38,Galago:1.00);" tree.primates <- read.tree(text = x) X <- c(4.09434, 3.61092, 2.37024, 2.02815, -1.46968) Y <- c(4.74493, 3.33220, 3.36730, 2.89037, 2.30259) compar.lynch(cbind(X, Y), G = vcv.phylo(tree.primates, cor = TRUE))
This function fits an Ornstein–Uhlenbeck model giving a phylogenetic tree, and a continuous character. The user specifies the node(s) where the optimum changes. The parameters are estimated by maximum likelihood; their standard-errors are computed assuming normality of these estimates.
compar.ou(x, phy, node = NULL, alpha = NULL)compar.ou(x, phy, node = NULL, alpha = NULL)
x |
a numeric vector giving the values of a continuous character. |
phy |
an object of class |
node |
a vector giving the number(s) of the node(s) where the
parameter ‘theta’ (the trait optimum) is assumed to change. The
node(s) can be specified with their labels if |
alpha |
the value of |
The Ornstein–Uhlenbeck (OU) process can be seen as a generalization
of the Brownian motion process. In the latter, characters are assumed
to evolve randomly under a random walk, that is change is equally
likely in any direction. In the OU model, change is more likely
towards the direction of an optimum (denoted ) with
a strength controlled by a parameter denoted .
The present function fits a model where the optimum parameter
, is allowed to vary throughout the tree. This is
specified with the argument node: changes
after each node whose number is given there. Note that the optimum
changes only for the lineages which are descendants of this
node.
Hansen (1997) recommends to not estimate together
with the other parameters. The present function allows this by giving
a numeric value to the argument alpha. By default, this
parameter is estimated, but this seems to yield very large
standard-errors, thus validating Hansen's recommendation. In practice,
a “poor man estimation” of can be done by
repeating the function call with different values of alpha, and
selecting the one that minimizes the deviance (see Hansen 1997 for an
example).
If x has names, its values are matched to the tip labels of
phy, otherwise its values are taken to be in the same order
than the tip labels of phy.
The user must be careful here since the function requires that both
series of names perfectly match, so this operation may fail if there
is a typing or syntax error. If both series of names do not match, the
values in the x are taken to be in the same order than the tip
labels of phy, and a warning message is issued.
an object of class "compar.ou" which is list with the following
components:
deviance |
the deviance (= -2 * loglik). |
para |
a data frame with the maximum likelihood estimates and their standard-errors. |
call |
the function call. |
The inversion of the variance-covariance matrix in the likelihood
function appeared as somehow problematic. The present implementation
uses a Cholevski decomposition with the function
chol2inv instead of the usual function
solve.
Emmanuel Paradis
Hansen, T. F. (1997) Stabilizing selection and the comparative analysis of adaptation. Evolution, 51, 1341–1351.
ace, compar.lynch,
corBrownian, corMartins, pic
data(bird.orders) ### This is likely to give you estimates close to 0, 1, and 0 ### for alpha, sigma^2, and theta, respectively: compar.ou(x <- rnorm(23), bird.orders) ### Much better with a fixed alpha: compar.ou(x, bird.orders, alpha = 0.1) ### Let us 'mimick' the effect of different optima ### for the two clades of birds... x <- c(rnorm(5, 0), rnorm(18, 5)) ### ... the model with two optima: compar.ou(x, bird.orders, node = 25, alpha = .1) ### ... and the model with a single optimum: compar.ou(x, bird.orders, node = NULL, alpha = .1) ### => Compare both models with the difference in deviances ## which follows a chi^2 with df = 1.data(bird.orders) ### This is likely to give you estimates close to 0, 1, and 0 ### for alpha, sigma^2, and theta, respectively: compar.ou(x <- rnorm(23), bird.orders) ### Much better with a fixed alpha: compar.ou(x, bird.orders, alpha = 0.1) ### Let us 'mimick' the effect of different optima ### for the two clades of birds... x <- c(rnorm(5, 0), rnorm(18, 5)) ### ... the model with two optima: compar.ou(x, bird.orders, node = 25, alpha = .1) ### ... and the model with a single optimum: compar.ou(x, bird.orders, node = NULL, alpha = .1) ### => Compare both models with the difference in deviances ## which follows a chi^2 with df = 1.
This function compares two phylogenetic trees, rooted or unrooted, and returns a detailed report of this comparison.
comparePhylo(x, y, plot = FALSE, force.rooted = FALSE, use.edge.length = FALSE, commons = TRUE, location = "bottomleft", ...) ## S3 method for class 'comparePhylo' print(x, ...)comparePhylo(x, y, plot = FALSE, force.rooted = FALSE, use.edge.length = FALSE, commons = TRUE, location = "bottomleft", ...) ## S3 method for class 'comparePhylo' print(x, ...)
x, y
|
two objects of class |
plot |
a logical value. If |
force.rooted |
a logical value. If |
use.edge.length |
a logical value passed to
|
commons |
whether to show the splits (the default), or the splits specific to each tree (applies only for unrooted trees). |
location |
location of where to position the |
... |
further parameters used by |
In all cases, the numbers of tips and of nodes and the tip labels are compared.
If both trees are rooted, or if force.rooted = TRUE, the clade
compositions of each tree are compared. If both trees are also
ultrametric, their branching times are compared.
If both trees are unrooted and have the same number of nodes, the bipartitions (aka splits) are compared.
If plot = TRUE, the edge lengths are not used by default
because in some situations with unrooted trees, some splits might not
be visible if the corresponding internal edge length is very short. To
use edge lengths, set use.edge.length = TRUE.
an object of class "comparePhylo" which is a list with messages
from the comparison and, optionally, tables comparing branching times.
Emmanuel Paradis, Klaus Schliep
## two unrooted trees but force comparison as rooted: a <- read.tree(text = "(a,b,(c,d));") b <- read.tree(text = "(a,c,(b,d));") comparePhylo(a, b, plot = TRUE, force.rooted = TRUE) ## two random unrooted trees: c <- rtree(5, rooted = FALSE) d <- rtree(5, rooted = FALSE) comparePhylo(c, d, plot = TRUE)## two unrooted trees but force comparison as rooted: a <- read.tree(text = "(a,b,(c,d));") b <- read.tree(text = "(a,c,(b,d));") comparePhylo(a, b, plot = TRUE, force.rooted = TRUE) ## two random unrooted trees: c <- rtree(5, rooted = FALSE) d <- rtree(5, rooted = FALSE) comparePhylo(c, d, plot = TRUE)
This function computes branch lengths of a tree using different methods.
compute.brlen(phy, method = "Grafen", power = 1, ...)compute.brlen(phy, method = "Grafen", power = 1, ...)
phy |
an object of class |
method |
the method to be used to compute the branch lengths;
this must be one of the followings: (i) |
power |
The power at which heights must be raised (see below). |
... |
further argument(s) to be passed to |
Grafen's (1989) computation of branch lengths: each node is given a ‘height’, namely the number of leaves of the subtree minus one, 0 for leaves. Each height is scaled so that root height is 1, and then raised at power 'rho' (> 0). Branch lengths are then computed as the difference between height of lower node and height of upper node.
If one or several numeric values are provided as method, they
are recycled if necessary. If a function is given instead, further
arguments are given in place of ... (they must be named, see
examples).
Zero-length branches are not treated as multichotomies, and thus may
need to be collapsed (see di2multi).
An object of class phylo with branch lengths.
Julien Dutheil [email protected] and Emmanuel Paradis
Grafen, A. (1989) The phylogenetic regression. Philosophical Transactions of the Royal society of London. Series B. Biological Sciences, 326, 119–157.
read.tree for a description of phylo objects,
di2multi, multi2di
data(bird.orders) plot(compute.brlen(bird.orders, 1)) plot(compute.brlen(bird.orders, runif, min = 0, max = 5)) layout(matrix(1:4, 2, 2)) plot(compute.brlen(bird.orders, power=1), main=expression(rho==1)) plot(compute.brlen(bird.orders, power=3), main=expression(rho==3)) plot(compute.brlen(bird.orders, power=0.5), main=expression(rho==0.5)) plot(compute.brlen(bird.orders, power=0.1), main=expression(rho==0.1)) layout(1)data(bird.orders) plot(compute.brlen(bird.orders, 1)) plot(compute.brlen(bird.orders, runif, min = 0, max = 5)) layout(matrix(1:4, 2, 2)) plot(compute.brlen(bird.orders, power=1), main=expression(rho==1)) plot(compute.brlen(bird.orders, power=3), main=expression(rho==3)) plot(compute.brlen(bird.orders, power=0.5), main=expression(rho==0.5)) plot(compute.brlen(bird.orders, power=0.1), main=expression(rho==0.1)) layout(1)
This function computes the branch lengths of a tree giving its branching times (aka node ages or heights).
compute.brtime(phy, method = "coalescent", force.positive = NULL)compute.brtime(phy, method = "coalescent", force.positive = NULL)
phy |
an object of class |
method |
either |
force.positive |
a logical value (see details). |
By default, a set of random branching times is generated from a simple
coalescent, and the option force.positive is set to TRUE
so that no branch length is negative.
If a numeric vector is passed to method, it is taken as the
branching times of the nodes with respect to their numbers (i.e., the
first element of method is the branching time of the node
numbered [= the root], the second element of the node
numbered , and so on), so force.positive is set to
FALSE. This may result in negative branch lengths. To avoid
this, one should use force.positive = TRUE in which case the
branching times are eventually reordered.
An object of class "phylo" with branch lengths and ultrametric.
Emmanuel Paradis
compute.brlen, branching.times
tr <- rtree(10) layout(matrix(1:4, 2)) plot(compute.brtime(tr)); axisPhylo() plot(compute.brtime(tr, force.positive = FALSE)); axisPhylo() plot(compute.brtime(tr, 1:9)); axisPhylo() # a bit nonsense plot(compute.brtime(tr, 1:9, TRUE)); axisPhylo() layout(1)tr <- rtree(10) layout(matrix(1:4, 2)) plot(compute.brtime(tr)); axisPhylo() plot(compute.brtime(tr, force.positive = FALSE)); axisPhylo() plot(compute.brtime(tr, 1:9)); axisPhylo() # a bit nonsense plot(compute.brtime(tr, 1:9, TRUE)); axisPhylo() layout(1)
Given a series of trees, this function returns the consensus tree. By
default, the strict-consensus tree is computed. To get the
majority-rule consensus tree, use p = 0.5. Any value between
0.5 and 1 can be used.
consensus(..., p = 1, check.labels = TRUE, rooted = FALSE)consensus(..., p = 1, check.labels = TRUE, rooted = FALSE)
... |
either (i) a single object of class |
p |
a numeric value between 0.5 and 1 giving the proportion for a clade to be represented in the consensus tree. |
check.labels |
a logical specifying whether to check the labels
of each tree. If |
rooted |
a logical specifying whether the trees should be treated as rooted or not. |
Using check.labels = FALSE results in
considerable decrease in computing times. This requires that all
trees have the same tip labels, and these labels are
ordered similarly in all trees (in other words, the element
tip.label are identical in all trees).
Until ape 5.6-2, the trees passed to this function were
implicitly treated as rooted, even when the option rooted =
FALSE was used. This is now fixed (see PR65 on GitHub) so that, by
default, the trees are explicitly treated as unrooted (even if
is.rooted returns TRUE). Thus, it could
be that results now differ from previous analyses (setting
rooted = TRUE might help to replicate previous results).
an object of class "phylo".
Emmanuel Paradis
Felsenstein, J. (2004) Inferring Phylogenies. Sunderland: Sinauer Associates.
cophenetic.phylo computes the pairwise distances between the
pairs of tips from a phylogenetic tree using its branch lengths.
dist.nodes does the same but between all nodes, internal and
terminal, of the tree.
## S3 method for class 'phylo' cophenetic(x) dist.nodes(x, fail.if.no.length = FALSE)## S3 method for class 'phylo' cophenetic(x) dist.nodes(x, fail.if.no.length = FALSE)
x |
an object of class |
fail.if.no.length |
a logical values. If the tree has no branch
lengths, these are all set equal to one (with a warning). If you
prefer to catch the case of no branch lengths with an error, set
this option to |
a numeric matrix with colnames and rownames set to the names of the
tips (as given by the element tip.label of the argument
phy), or, in the case of dist.nodes, the numbers of the
tips and the nodes (as given by the element edge).
Emmanuel Paradis
read.tree to read tree files in Newick format,
cophenetic for the generic function
This function plots two trees face to face with the links if specified. It is possible to rotate the branches of each tree around the nodes by clicking.
cophyloplot(x, y, assoc = NULL, use.edge.length = FALSE, space = 0, length.line = 1, gap = 2, type = "phylogram", rotate = FALSE, col = par("fg"), lwd = par("lwd"), lty = par("lty"), show.tip.label = TRUE, font = 3, ..., node.depth=2)cophyloplot(x, y, assoc = NULL, use.edge.length = FALSE, space = 0, length.line = 1, gap = 2, type = "phylogram", rotate = FALSE, col = par("fg"), lwd = par("lwd"), lty = par("lty"), show.tip.label = TRUE, font = 3, ..., node.depth=2)
x, y
|
two objects of class |
assoc |
a matrix with 2 columns specifying the associations between the tips. If NULL, no links will be drawn. |
use.edge.length |
a logical indicating whether the branch lengths should be used to plot the trees; default is FALSE. |
space |
a positive value that specifies the distance between the two trees. |
length.line |
a positive value that specifies the length of the horizontal line associated to each taxa. Default is 1. |
gap |
a value specifying the distance between the tips of the phylogeny and the lines. |
type |
a character string specifying the type of phylogeny to be drawn; it must be one of "phylogram" (the default) or "cladogram". |
rotate |
a logical indicating whether the nodes of the phylogeny can be rotated by clicking. Default is FALSE. |
col |
a character vector indicating the color to be used for the links; recycled as necessary. |
lwd |
id. for the width. |
lty |
id. for the line type. |
show.tip.label |
a logical indicating whether to show the tip labels on the phylogeny (defaults to 'TRUE', i.e. the labels are shown). |
font |
an integer specifying the type of font for the labels: 1 (plain text), 2 (bold), 3 (italic, the default), or 4 (bold italic). |
node.depth |
an integer value (1 or 2) used if branch lengths are not used to plot the tree; 1: the node depths are proportional to the number of tips descending from each node (the default and was the only possibility previously), 2: they are evenly spaced. |
... |
(unused) |
The aim of this function is to plot simultaneously two phylogenetic trees with associated taxa. The two trees do not necessarily have the same number of tips and more than one tip in one phylogeny can be associated with a tip in the other.
The association matrix used to draw the links has to be a matrix with two columns containing the names of the tips. One line in the matrix represents one link on the plot. The first column of the matrix has to contain tip labels of the first tree (phy1) and the second column of the matrix, tip labels of the second tree (phy2). There is no limit (low or high) for the number of lines in the matrix. A matrix with two colums and one line will give a plot with one link.
Arguments gap, length.line and space have to be changed to get a nice plot of the two phylogenies. Note that the function takes into account the length of the character strings corresponding to the names at the tips, so that the lines do not overwrite those names.
The rotate argument can be used to transform both phylogenies in order to get the more readable plot (typically by decreasing the number of crossing lines). This can be done by clicking on the nodes. The escape button or right click take back to the console.
Damien de Vienne [email protected]
plot.phylo, rotate, rotateConstr
#two random trees tree1 <- rtree(40) tree2 <- rtree(20) #creation of the association matrix: association <- cbind(tree2$tip.label, tree2$tip.label) cophyloplot(tree1, tree2, assoc = association, length.line = 4, space = 28, gap = 3) #plot with rotations ## Not run: cophyloplot(tree1, tree2, assoc=association, length.line=4, space=28, gap=3, rotate=TRUE) ## End(Not run)#two random trees tree1 <- rtree(40) tree2 <- rtree(20) #creation of the association matrix: association <- cbind(tree2$tip.label, tree2$tip.label) cophyloplot(tree1, tree2, assoc = association, length.line = 4, space = 28, gap = 3) #plot with rotations ## Not run: cophyloplot(tree1, tree2, assoc=association, length.line=4, space=28, gap=3, rotate=TRUE) ## End(Not run)
The “ACDC” (accelerated/decelerated) model assumes that continuous
traits evolve under a Brownian motion model which rates accelerates
(if < 1) or decelerates (if > 1) through
time. If = 1, then the model reduces to a Brownian motion
model.
corBlomberg(value, phy, form = ~1, fixed = FALSE) ## S3 method for class 'corBlomberg' corMatrix(object, covariate = getCovariate(object), corr = TRUE, ...) ## S3 method for class 'corBlomberg' coef(object, unconstrained = TRUE, ...)corBlomberg(value, phy, form = ~1, fixed = FALSE) ## S3 method for class 'corBlomberg' corMatrix(object, covariate = getCovariate(object), corr = TRUE, ...) ## S3 method for class 'corBlomberg' coef(object, unconstrained = TRUE, ...)
value |
the (initial) value of the parameter |
phy |
an object of class |
form |
a one sided formula of the form ~ t, or ~ t | g, specifying the taxa covariate t and, optionally, a grouping factor g. A covariate for this correlation structure must be character valued, with entries matching the tip labels in the phylogenetic tree. When a grouping factor is present in form, the correlation structure is assumed to apply only to observations within the same grouping level; observations with different grouping levels are assumed to be uncorrelated. Defaults to ~ 1, which corresponds to using the order of the observations in the data as a covariate, and no groups. |
fixed |
a logical specifying whether |
object |
an (initialized) object of class |
covariate |
an optional covariate vector (matrix), or list of covariate vectors (matrices), at which values the correlation matrix, or list of correlation matrices, are to be evaluated. Defaults to getCovariate(object). |
corr |
a logical value specifying whether to return the correlation matrix (the default) or the variance-covariance matrix. |
unconstrained |
a logical value. If |
... |
further arguments passed to or from other methods. |
an object of class "corBlomberg", the coefficients from an
object of this class, or the correlation matrix of an initialized
object of this class. In most situations, only corBlomberg will
be called by the user.
Emmanuel Paradis
Blomberg, S. P., Garland, Jr, T., and Ives, A. R. (2003) Testing for phylogenetic signal in comparative data: behavioral traits are more labile. Evolution, 57, 717–745.
Expected covariance under a Brownian model (Felsenstein 1985, Martins and Hansen 1997)
where is the distance on the phylogeny between the root
and the most recent common ancestor of taxa and
and is a constant.
corBrownian(value=1, phy, form=~1) ## S3 method for class 'corBrownian' coef(object, unconstrained = TRUE, ...) ## S3 method for class 'corBrownian' corMatrix(object, covariate = getCovariate(object), corr = TRUE, ...)corBrownian(value=1, phy, form=~1) ## S3 method for class 'corBrownian' coef(object, unconstrained = TRUE, ...) ## S3 method for class 'corBrownian' corMatrix(object, covariate = getCovariate(object), corr = TRUE, ...)
value |
The |
phy |
An object of class |
object |
An (initialized) object of class |
corr |
a logical value. If 'TRUE' the function returns the correlation matrix, otherwise it returns the variance/covariance matrix. |
form |
a one sided formula of the form ~ t, or ~ t | g, specifying the taxa covariate t and, optionally, a grouping factor g. A covariate for this correlation structure must be character valued, with entries matching the tip labels in the phylogenetic tree. When a grouping factor is present in form, the correlation structure is assumed to apply only to observations within the same grouping level; observations with different grouping levels are assumed to be uncorrelated. Defaults to ~ 1, which corresponds to using the order of the observations in the data as a covariate, and no groups. |
covariate |
an optional covariate vector (matrix), or list of covariate vectors (matrices), at which values the correlation matrix, or list of correlation matrices, are to be evaluated. Defaults to getCovariate(object). |
unconstrained |
a logical value. If 'TRUE' the coefficients are returned in unconstrained form (the same used in the optimization algorithm). If 'FALSE' the coefficients are returned in "natural", possibly constrained, form. Defaults to 'TRUE' |
... |
some methods for these generics require additional arguments. None are used in these methods. |
An object of class corBrownian, or the coefficient from an
object of this class (actually sends numeric(0)), or the
correlation matrix of an initialized object of this class.
Julien Dutheil [email protected]
Felsenstein, J. (1985) Phylogenies and the comparative method. American Naturalist, 125, 1–15.
Martins, E. P. and Hansen, T. F. (1997) Phylogenies and the comparative method: a general approach to incorporating phylogenetic information into the analysis of interspecific data. American Naturalist, 149, 646–667.
Classes of phylogenetic correlation structures ("corPhyl")
available in ape.
corBrownian: Brownian motion model (Felsenstein 1985)
corMartins: The covariance matrix defined in Martins and Hansen (1997)
corGrafen: The covariance matrix defined in Grafen (1989)
corPagel: The covariance matrix defined in Freckelton et al. (2002)
corBlomberg: The covariance matrix defined in Blomberg et al. (2003)
See the help page of each class for references and detailed description.
Julien Dutheil [email protected], Emmanuel Paradis
corClasses and gls in the
nlme librarie, corBrownian,
corMartins, corGrafen,
corPagel, corBlomberg,
vcv, vcv2phylo
library(nlme) txt <- "((((Homo:0.21,Pongo:0.21):0.28,Macaca:0.49):0.13,Ateles:0.62):0.38,Galago:1.00);" tree.primates <- read.tree(text = txt) X <- c(4.09434, 3.61092, 2.37024, 2.02815, -1.46968) Y <- c(4.74493, 3.33220, 3.36730, 2.89037, 2.30259) Species <- c("Homo", "Pongo", "Macaca", "Ateles", "Galago") dat <- data.frame(Species = Species, X = X, Y = Y) m1 <- gls(Y ~ X, dat, correlation=corBrownian(1, tree.primates, form = ~Species)) summary(m1) m2 <- gls(Y ~ X, dat, correlation=corMartins(1, tree.primates, form = ~Species)) summary(m2) corMatrix(m2$modelStruct$corStruct) m3 <- gls(Y ~ X, dat, correlation=corGrafen(1, tree.primates, form = ~Species)) summary(m3) corMatrix(m3$modelStruct$corStruct)library(nlme) txt <- "((((Homo:0.21,Pongo:0.21):0.28,Macaca:0.49):0.13,Ateles:0.62):0.38,Galago:1.00);" tree.primates <- read.tree(text = txt) X <- c(4.09434, 3.61092, 2.37024, 2.02815, -1.46968) Y <- c(4.74493, 3.33220, 3.36730, 2.89037, 2.30259) Species <- c("Homo", "Pongo", "Macaca", "Ateles", "Galago") dat <- data.frame(Species = Species, X = X, Y = Y) m1 <- gls(Y ~ X, dat, correlation=corBrownian(1, tree.primates, form = ~Species)) summary(m1) m2 <- gls(Y ~ X, dat, correlation=corMartins(1, tree.primates, form = ~Species)) summary(m2) corMatrix(m2$modelStruct$corStruct) m3 <- gls(Y ~ X, dat, correlation=corGrafen(1, tree.primates, form = ~Species)) summary(m3) corMatrix(m3$modelStruct$corStruct)
Grafen's (1989) covariance structure. Branch lengths are computed using
Grafen's method (see compute.brlen). The covariance
matrice is then the traditional variance-covariance matrix for a
phylogeny.
corGrafen(value, phy, form=~1, fixed = FALSE) ## S3 method for class 'corGrafen' coef(object, unconstrained = TRUE, ...) ## S3 method for class 'corGrafen' corMatrix(object, covariate = getCovariate(object), corr = TRUE, ...)corGrafen(value, phy, form=~1, fixed = FALSE) ## S3 method for class 'corGrafen' coef(object, unconstrained = TRUE, ...) ## S3 method for class 'corGrafen' corMatrix(object, covariate = getCovariate(object), corr = TRUE, ...)
value |
The |
phy |
An object of class |
object |
An (initialized) object of class |
corr |
a logical value. If 'TRUE' the function returns the correlation matrix, otherwise it returns the variance/covariance matrix. |
fixed |
an optional logical value indicating whether the coefficients should be allowed to vary in the optimization, or kept fixed at their initial value. Defaults to 'FALSE', in which case the coefficients are allowed to vary. |
form |
a one sided formula of the form ~ t, or ~ t | g, specifying the taxa covariate t and, optionally, a grouping factor g. A covariate for this correlation structure must be character valued, with entries matching the tip labels in the phylogenetic tree. When a grouping factor is present in form, the correlation structure is assumed to apply only to observations within the same grouping level; observations with different grouping levels are assumed to be uncorrelated. Defaults to ~ 1, which corresponds to using the order of the observations in the data as a covariate, and no groups. |
covariate |
an optional covariate vector (matrix), or list of covariate vectors (matrices), at which values the correlation matrix, or list of correlation matrices, are to be evaluated. Defaults to getCovariate(object). |
unconstrained |
a logical value. If 'TRUE' the coefficients are returned in unconstrained form (the same used in the optimization algorithm). If 'FALSE' the coefficients are returned in "natural", possibly constrained, form. Defaults to 'TRUE' |
... |
some methods for these generics require additional arguments. None are used in these methods. |
An object of class corGrafen or the rho coefficient from an
object of this class or the correlation matrix of an initialized
object of this class.
Julien Dutheil [email protected]
Grafen, A. (1989) The phylogenetic regression. Philosophical Transactions of the Royal society of London. Series B. Biological Sciences, 326, 119–157.
corClasses, compute.brlen, vcv.phylo.
Martins and Hansen's (1997) covariance structure:
where is the phylogenetic distance between taxa and and is a constant.
corMartins(value, phy, form = ~1, fixed = FALSE) ## S3 method for class 'corMartins' coef(object, unconstrained = TRUE, ...) ## S3 method for class 'corMartins' corMatrix(object, covariate = getCovariate(object), corr = TRUE, ...)corMartins(value, phy, form = ~1, fixed = FALSE) ## S3 method for class 'corMartins' coef(object, unconstrained = TRUE, ...) ## S3 method for class 'corMartins' corMatrix(object, covariate = getCovariate(object), corr = TRUE, ...)
value |
The |
phy |
An object of class |
object |
An (initialized) object of class |
corr |
a logical value. If 'TRUE' the function returns the correlation matrix, otherwise it returns the variance/covariance matrix. |
fixed |
an optional logical value indicating whether the coefficients should be allowed to vary in the optimization, ok kept fixed at their initial value. Defaults to 'FALSE', in which case the coefficients are allowed to vary. |
form |
a one sided formula of the form ~ t, or ~ t | g, specifying the taxa covariate t and, optionally, a grouping factor g. A covariate for this correlation structure must be character valued, with entries matching the tip labels in the phylogenetic tree. When a grouping factor is present in form, the correlation structure is assumed to apply only to observations within the same grouping level; observations with different grouping levels are assumed to be uncorrelated. Defaults to ~ 1, which corresponds to using the order of the observations in the data as a covariate, and no groups. |
covariate |
an optional covariate vector (matrix), or list of covariate vectors (matrices), at which values the correlation matrix, or list of correlation matrices, are to be evaluated. Defaults to getCovariate(object). |
unconstrained |
a logical value. If 'TRUE' the coefficients are returned in unconstrained form (the same used in the optimization algorithm). If 'FALSE' the coefficients are returned in "natural", possibly constrained, form. Defaults to 'TRUE' |
... |
some methods for these generics require additional arguments. None are used in these methods. |
An object of class corMartins or the alpha coefficient from an object of this class
or the correlation matrix of an initialized object of this class.
Julien Dutheil [email protected]
Martins, E. P. and Hansen, T. F. (1997) Phylogenies and the comparative method: a general approach to incorporating phylogenetic information into the analysis of interspecific data. American Naturalist, 149, 646–667.
The correlation structure from the present model is derived from the
Brownian motion model by multiplying the off-diagonal elements (i.e.,
the covariances) by . The variances are thus the
same than for a Brownian motion model.
corPagel(value, phy, form = ~1, fixed = FALSE) ## S3 method for class 'corPagel' corMatrix(object, covariate = getCovariate(object), corr = TRUE, ...) ## S3 method for class 'corPagel' coef(object, unconstrained = TRUE, ...)corPagel(value, phy, form = ~1, fixed = FALSE) ## S3 method for class 'corPagel' corMatrix(object, covariate = getCovariate(object), corr = TRUE, ...) ## S3 method for class 'corPagel' coef(object, unconstrained = TRUE, ...)
value |
the (initial) value of the parameter
|
phy |
an object of class |
form |
a one sided formula of the form ~ t, or ~ t | g, specifying the taxa covariate t and, optionally, a grouping factor g. A covariate for this correlation structure must be character valued, with entries matching the tip labels in the phylogenetic tree. When a grouping factor is present in form, the correlation structure is assumed to apply only to observations within the same grouping level; observations with different grouping levels are assumed to be uncorrelated. Defaults to ~ 1, which corresponds to using the order of the observations in the data as a covariate, and no groups. |
fixed |
a logical specifying whether |
object |
an (initialized) object of class |
covariate |
an optional covariate vector (matrix), or list of covariate vectors (matrices), at which values the correlation matrix, or list of correlation matrices, are to be evaluated. Defaults to getCovariate(object). |
corr |
a logical value specifying whether to return the correlation matrix (the default) or the variance-covariance matrix. |
unconstrained |
a logical value. If |
... |
further arguments passed to or from other methods. |
an object of class "corPagel", the coefficients from an object
of this class, or the correlation matrix of an initialized object of
this class. In most situations, only corPagel will be called
by the user.
Emmanuel Paradis
Freckleton, R. P., Harvey, P. H. and M. Pagel, M. (2002) Phylogenetic analysis and comparative data: a test and review of evidence. American Naturalist, 160, 712–726.
Pagel, M. (1999) Inferring the historical patterns of biological evolution. Nature, 401,877–884.
This function calculates Pearson correlation coefficients for multiple continuous traits that may have phylogenetic signal, allowing users to specify measurement error as the standard error of trait values at the tips of the phylogenetic tree. Phylogenetic signal for each trait is estimated from the data assuming that trait evolution is given by a Ornstein-Uhlenbeck process. Thus, the function allows the estimation of phylogenetic signal in multiple traits while incorporating correlations among traits. It is also possible to include independent variables (covariates) for each trait to remove possible confounding effects. corphylo() returns the correlation matrix for trait values, estimates of phylogenetic signal for each trait, and regression coefficients for independent variables affecting each trait.
corphylo(X, U = list(), SeM = NULL, phy = NULL, REML = TRUE, method = c("Nelder-Mead", "SANN"), constrain.d = FALSE, reltol = 10^-6, maxit.NM = 1000, maxit.SA = 1000, temp.SA = 1, tmax.SA = 1, verbose = FALSE) ## S3 method for class 'corphylo' print(x, digits = max(3, getOption("digits") - 3), ...)corphylo(X, U = list(), SeM = NULL, phy = NULL, REML = TRUE, method = c("Nelder-Mead", "SANN"), constrain.d = FALSE, reltol = 10^-6, maxit.NM = 1000, maxit.SA = 1000, temp.SA = 1, tmax.SA = 1, verbose = FALSE) ## S3 method for class 'corphylo' print(x, digits = max(3, getOption("digits") - 3), ...)
X |
a n x p matrix with p columns containing the values for the n taxa. Rows of X should have rownames matching the taxon names in phy. |
U |
a list of p matrices corresponding to the p columns of X, with each matrix containing independent variables for the corresponding column of X. The rownames of each matrix within U must be the same as X, or alternatively, the order of values in rows must match those in X. If U is omitted, only the mean (aka intercept) for each column of X is estimated. If U[[i]] is NULL, only an intercept is estimated for X[, i]. If all values of U[[i]][j] are the same, this variable is automatically dropped from the analysis (i.e., there is no offset in the regression component of the model). |
SeM |
a n x p matrix with p columns containing standard errors of the trait values in X. The rownames of SeM must be the same as X, or alternatively, the order of values in rows must match those in X. If SeM is omitted, the trait values are assumed to be known without error. If only some traits have mesurement errors, the remaining traits can be given zero-valued standard errors. |
phy |
a phylo object giving the phylogenetic tree. The rownames of phy must be the same as X, or alternatively, the order of values in rows must match those in X. |
REML |
whether REML or ML is used for model fitting. |
method |
in optim(), either Nelder-Mead simplex minimization or SANN (simulated annealing) minimization is used. If SANN is used, it is followed by Nelder-Mead minimization. |
constrain.d |
if constrain.d is TRUE, the estimates of d are constrained to be between zero and 1. This can make estimation more stable and can be tried if convergence is problematic. This does not necessarily lead to loss of generality of the results, because before using corphylo, branch lengths of phy can be transformed so that the "starter" tree has strong phylogenetic signal. |
reltol |
a control parameter dictating the relative tolerance for convergence in the optimization; see optim(). |
maxit.NM |
a control parameter dictating the maximum number of iterations in the optimization with Nelder-Mead minimization; see optim(). |
maxit.SA |
a control parameter dictating the maximum number of iterations in the optimization with SANN minimization; see optim(). |
temp.SA |
a control parameter dictating the starting temperature in the optimization with SANN minimization; see optim(). |
tmax.SA |
a control parameter dictating the number of function evaluations at each temperature in the optimization with SANN minimization; see optim(). |
verbose |
if TRUE, the model logLik and running estimates of the correlation coefficients and values of d are printed each iteration during optimization. |
x |
an objects of class corphylo. |
digits |
the number of digits to be printed. |
... |
arguments passed to and from other methods. |
For the case of two variables, the function estimates parameters for the model of the form, for example,
where , , , and are regression coefficients, and is a variance-covariance matrix containing the correlation coefficient r, parameters of the OU process and , and diagonal matrices and of measurement standard errors for and . The matrix is , with blocks given by
where are derived from phy under the assumption of joint OU evolutionary processes for each trait (see Zheng et al. 2009). This formulation extends in the obvious way to more than two traits.
An object of class "corphylo".
cor.matrix |
the p x p matrix of correlation coefficients. |
d |
values of d from the OU process for each trait. |
B |
estimates of the regression coefficients, including intercepts. Coefficients are named according to the list U. For example, B1.2 is the coefficient corresponding to U[[1]][, 2], and if column 2 in U[[1]] is named "colname2", then the coefficient will be B1.colname2. Intercepts have the form B1.0. |
B.se |
standard errors of the regression coefficients. |
B.cov |
covariance matrix for regression coefficients. |
B.zscore |
Z scores for the regression coefficients. |
B.pvalue |
tests for the regression coefficients being different from zero. |
logLik |
he log likelihood for either the restricted likelihood (REML = TRUE) or the overall likelihood (REML = FALSE). |
AIC |
AIC for either the restricted likelihood (REML = TRUE) or the overall likelihood (REML = FALSE). |
BIC |
BIC for either the restricted likelihood (REML = TRUE) or the overall likelihood (REML = FALSE). |
REML |
whether REML is used rather than ML (TRUE or FALSE). |
constrain.d |
whether or not values of d were constrained to be between 0 and 1 (TRUE or FALSE). |
XX |
values of X in vectorized form, with each trait X[, i] standardized to have mean zero and standard deviation one. |
UU |
design matrix with values in UU corresponding to XX; each variable U[[i]][, j] is standardized to have mean zero and standard deviation one. |
MM |
vector of measurement standard errors corresponding to XX, with the standard errors suitably standardized. |
Vphy |
the phylogenetic covariance matrix computed from phy and standardized to have determinant equal to one. |
R |
covariance matrix of trait values relative to the standardized values of XX. |
V |
overall estimated covariance matrix of residuals for XX including trait correlations, phylogenetic signal, and measurement error variances. This matrix can be used to simulate data for parametric bootstrapping. See examples. |
C |
matrix V excluding measurement error variances. |
convcode |
he convergence code provided by optim(). |
niter |
number of iterations performed by optim(). |
Anthony R. Ives
Zheng, L., A. R. Ives, T. Garland, B. R. Larget, Y. Yu, and K. F. Cao. 2009. New multivariate tests for phylogenetic signal and trait correlations applied to ecophysiological phenotypes of nine Manglietia species. Functional Ecology 23:1059–1069.
## Simple example using data without correlations or phylogenetic ## signal. This illustrates the structure of the input data. phy <- rcoal(10, tip.label = 1:10) X <- matrix(rnorm(20), nrow = 10, ncol = 2) rownames(X) <- phy$tip.label U <- list(NULL, matrix(rnorm(10, mean = 10, sd = 4), nrow = 10, ncol = 1)) rownames(U[[2]]) <- phy$tip.label SeM <- matrix(c(0.2, 0.4), nrow = 10, ncol = 2) rownames(SeM) <- phy$tip.label corphylo(X = X, SeM = SeM, U = U, phy = phy, method = "Nelder-Mead") ## Not run: ## Simulation example for the correlation between two variables. The ## example compares the estimates of the correlation coefficients from ## corphylo when measurement error is incorporated into the analyses with ## three other cases: (i) when measurement error is excluded, (ii) when ## phylogenetic signal is ignored (assuming a "star" phylogeny), and (iii) ## neither measurement error nor phylogenetic signal are included. ## In the simulations, variable 2 is associated with a single ## independent variable. This requires setting up a list U that has 2 ## elements: element U[[1]] is NULL and element U[[2]] is a n x 1 vector ## containing simulated values of the independent variable. # Set up parameter values for simulating data n <- 50 phy <- rcoal(n, tip.label = 1:n) R <- matrix(c(1, 0.7, 0.7, 1), nrow = 2, ncol = 2) d <- c(0.3, .95) B2 <- 1 Se <- c(0.2, 1) SeM <- matrix(Se, nrow = n, ncol = 2, byrow = T) rownames(SeM) <- phy$tip.label # Set up needed matrices for the simulations p <- length(d) star <- stree(n) star$edge.length <- array(1, dim = c(n, 1)) star$tip.label <- phy$tip.label Vphy <- vcv(phy) Vphy <- Vphy/max(Vphy) Vphy <- Vphy/exp(determinant(Vphy)$modulus[1]/n) tau <- matrix(1, nrow = n, ncol = 1) C <- matrix(0, nrow = p * n, ncol = p * n) for (i in 1:p) for (j in 1:p) { Cd <- (d[i]^tau * (d[j]^t(tau)) * (1 - (d[i] * d[j])^Vphy))/(1 - d[i] * d[j]) C[(n * (i - 1) + 1):(i * n), (n * (j - 1) + 1):(j * n)] <- R[i, j] * Cd } MM <- matrix(SeM^2, ncol = 1) V <- C + diag(as.numeric(MM)) ## Perform a Cholesky decomposition of Vphy. This is used to generate ## phylogenetic signal: a vector of independent normal random variables, ## when multiplied by the transpose of the Cholesky deposition of Vphy will ## have covariance matrix equal to Vphy. iD <- t(chol(V)) # Perform Nrep simulations and collect the results Nrep <- 100 cor.list <- matrix(0, nrow = Nrep, ncol = 1) cor.noM.list <- matrix(0, nrow = Nrep, ncol = 1) cor.noP.list <- matrix(0, nrow = Nrep, ncol = 1) cor.noMP.list <- matrix(0, nrow = Nrep, ncol = 1) d.list <- matrix(0, nrow = Nrep, ncol = 2) d.noM.list <- matrix(0, nrow = Nrep, ncol = 2) B.list <- matrix(0, nrow = Nrep, ncol = 3) B.noM.list <- matrix(0, nrow = Nrep, ncol = 3) B.noP.list <- matrix(0, nrow = Nrep, ncol = 3) for (rep in 1:Nrep) { XX <- iD X <- matrix(XX, nrow = n, ncol = 2) rownames(X) <- phy$tip.label U <- list(NULL, matrix(rnorm(n, mean = 2, sd = 10), nrow = n, ncol = 1)) rownames(U[[2]]) <- phy$tip.label colnames(U[[2]]) <- "V1" X[,2] <- X[,2] + B2[1] * U[[2]][,1] - B2[1] * mean(U[[2]][,1]) z <- corphylo(X = X, SeM = SeM, U = U, phy = phy, method = "Nelder-Mead") z.noM <- corphylo(X = X, U = U, phy = phy, method = "Nelder-Mead") z.noP <- corphylo(X = X, SeM = SeM, U = U, phy = star, method = "Nelder-Mead") cor.list[rep] <- z$cor.matrix[1, 2] cor.noM.list[rep] <- z.noM$cor.matrix[1, 2] cor.noP.list[rep] <- z.noP$cor.matrix[1, 2] cor.noMP.list[rep] <- cor(cbind(lm(X[,1] ~ 1)$residuals, lm(X[,2] ~ U[[2]])$residuals))[1,2] d.list[rep, ] <- z$d d.noM.list[rep, ] <- z.noM$d B.list[rep, ] <- z$B B.noM.list[rep, ] <- z.noM$B B.noP.list[rep, ] <- z.noP$B show(c(rep, z$convcode, z$cor.matrix[1, 2], z$d)) } correlation <- rbind(R[1, 2], mean(cor.list), mean(cor.noM.list), mean(cor.noP.list), mean(cor.noMP.list)) rownames(correlation) <- c("True", "With SeM and Phy", "Without SeM", "Without Phy", "Without Phy or SeM") correlation signal.d <- rbind(d, colMeans(d.list), colMeans(d.noM.list)) rownames(signal.d) <- c("True", "With SeM and Phy", "Without SeM") signal.d est.B <- rbind(c(0, 0, B2), colMeans(B.list), colMeans(B.noM.list), colMeans(B.noP.list)) rownames(est.B) <- c("True", "With SeM and Phy", "Without SeM", "Without Phy") colnames(est.B) <- rownames(z$B) est.B # Example simulation output # correlation # [,1] # True 0.7000000 # With SeM and Phy 0.7055958 # Without SeM 0.3125253 # Without Phy 0.4054043 # Without Phy or SeM 0.3476589 # signal.d # [,1] [,2] # True 0.300000 0.9500000 # With SeM and Phy 0.301513 0.9276663 # Without SeM 0.241319 0.4872675 # est.B # B1.0 B2.0 B2.V1 # True 0.00000000 0.0000000 1.0000000 # With SeM and Phy -0.01285834 0.2807215 0.9963163 # Without SeM 0.01406953 0.3059110 0.9977796 # Without Phy 0.02139281 0.3165731 0.9942140 ## End(Not run)## Simple example using data without correlations or phylogenetic ## signal. This illustrates the structure of the input data. phy <- rcoal(10, tip.label = 1:10) X <- matrix(rnorm(20), nrow = 10, ncol = 2) rownames(X) <- phy$tip.label U <- list(NULL, matrix(rnorm(10, mean = 10, sd = 4), nrow = 10, ncol = 1)) rownames(U[[2]]) <- phy$tip.label SeM <- matrix(c(0.2, 0.4), nrow = 10, ncol = 2) rownames(SeM) <- phy$tip.label corphylo(X = X, SeM = SeM, U = U, phy = phy, method = "Nelder-Mead") ## Not run: ## Simulation example for the correlation between two variables. The ## example compares the estimates of the correlation coefficients from ## corphylo when measurement error is incorporated into the analyses with ## three other cases: (i) when measurement error is excluded, (ii) when ## phylogenetic signal is ignored (assuming a "star" phylogeny), and (iii) ## neither measurement error nor phylogenetic signal are included. ## In the simulations, variable 2 is associated with a single ## independent variable. This requires setting up a list U that has 2 ## elements: element U[[1]] is NULL and element U[[2]] is a n x 1 vector ## containing simulated values of the independent variable. # Set up parameter values for simulating data n <- 50 phy <- rcoal(n, tip.label = 1:n) R <- matrix(c(1, 0.7, 0.7, 1), nrow = 2, ncol = 2) d <- c(0.3, .95) B2 <- 1 Se <- c(0.2, 1) SeM <- matrix(Se, nrow = n, ncol = 2, byrow = T) rownames(SeM) <- phy$tip.label # Set up needed matrices for the simulations p <- length(d) star <- stree(n) star$edge.length <- array(1, dim = c(n, 1)) star$tip.label <- phy$tip.label Vphy <- vcv(phy) Vphy <- Vphy/max(Vphy) Vphy <- Vphy/exp(determinant(Vphy)$modulus[1]/n) tau <- matrix(1, nrow = n, ncol = 1) C <- matrix(0, nrow = p * n, ncol = p * n) for (i in 1:p) for (j in 1:p) { Cd <- (d[i]^tau * (d[j]^t(tau)) * (1 - (d[i] * d[j])^Vphy))/(1 - d[i] * d[j]) C[(n * (i - 1) + 1):(i * n), (n * (j - 1) + 1):(j * n)] <- R[i, j] * Cd } MM <- matrix(SeM^2, ncol = 1) V <- C + diag(as.numeric(MM)) ## Perform a Cholesky decomposition of Vphy. This is used to generate ## phylogenetic signal: a vector of independent normal random variables, ## when multiplied by the transpose of the Cholesky deposition of Vphy will ## have covariance matrix equal to Vphy. iD <- t(chol(V)) # Perform Nrep simulations and collect the results Nrep <- 100 cor.list <- matrix(0, nrow = Nrep, ncol = 1) cor.noM.list <- matrix(0, nrow = Nrep, ncol = 1) cor.noP.list <- matrix(0, nrow = Nrep, ncol = 1) cor.noMP.list <- matrix(0, nrow = Nrep, ncol = 1) d.list <- matrix(0, nrow = Nrep, ncol = 2) d.noM.list <- matrix(0, nrow = Nrep, ncol = 2) B.list <- matrix(0, nrow = Nrep, ncol = 3) B.noM.list <- matrix(0, nrow = Nrep, ncol = 3) B.noP.list <- matrix(0, nrow = Nrep, ncol = 3) for (rep in 1:Nrep) { XX <- iD X <- matrix(XX, nrow = n, ncol = 2) rownames(X) <- phy$tip.label U <- list(NULL, matrix(rnorm(n, mean = 2, sd = 10), nrow = n, ncol = 1)) rownames(U[[2]]) <- phy$tip.label colnames(U[[2]]) <- "V1" X[,2] <- X[,2] + B2[1] * U[[2]][,1] - B2[1] * mean(U[[2]][,1]) z <- corphylo(X = X, SeM = SeM, U = U, phy = phy, method = "Nelder-Mead") z.noM <- corphylo(X = X, U = U, phy = phy, method = "Nelder-Mead") z.noP <- corphylo(X = X, SeM = SeM, U = U, phy = star, method = "Nelder-Mead") cor.list[rep] <- z$cor.matrix[1, 2] cor.noM.list[rep] <- z.noM$cor.matrix[1, 2] cor.noP.list[rep] <- z.noP$cor.matrix[1, 2] cor.noMP.list[rep] <- cor(cbind(lm(X[,1] ~ 1)$residuals, lm(X[,2] ~ U[[2]])$residuals))[1,2] d.list[rep, ] <- z$d d.noM.list[rep, ] <- z.noM$d B.list[rep, ] <- z$B B.noM.list[rep, ] <- z.noM$B B.noP.list[rep, ] <- z.noP$B show(c(rep, z$convcode, z$cor.matrix[1, 2], z$d)) } correlation <- rbind(R[1, 2], mean(cor.list), mean(cor.noM.list), mean(cor.noP.list), mean(cor.noMP.list)) rownames(correlation) <- c("True", "With SeM and Phy", "Without SeM", "Without Phy", "Without Phy or SeM") correlation signal.d <- rbind(d, colMeans(d.list), colMeans(d.noM.list)) rownames(signal.d) <- c("True", "With SeM and Phy", "Without SeM") signal.d est.B <- rbind(c(0, 0, B2), colMeans(B.list), colMeans(B.noM.list), colMeans(B.noP.list)) rownames(est.B) <- c("True", "With SeM and Phy", "Without SeM", "Without Phy") colnames(est.B) <- rownames(z$B) est.B # Example simulation output # correlation # [,1] # True 0.7000000 # With SeM and Phy 0.7055958 # Without SeM 0.3125253 # Without Phy 0.4054043 # Without Phy or SeM 0.3476589 # signal.d # [,1] [,2] # True 0.300000 0.9500000 # With SeM and Phy 0.301513 0.9276663 # Without SeM 0.241319 0.4872675 # est.B # B1.0 B2.0 B2.V1 # True 0.00000000 0.0000000 1.0000000 # With SeM and Phy -0.01285834 0.2807215 0.9963163 # Without SeM 0.01406953 0.3059110 0.9977796 # Without Phy 0.02139281 0.3165731 0.9942140 ## End(Not run)
This function computes a correlogram from taxonomic levels.
correlogram.formula(formula, data = NULL, use = "all.obs")correlogram.formula(formula, data = NULL, use = "all.obs")
formula |
a formula of the type |
data |
a data frame containing the variables specified in the
formula. If |
use |
a character string specifying how to handle missing
values (i.e., |
See the vignette in R: vignette("MoranI").
An object of class correlogram which is a data frame with three
columns:
obs |
the computed Moran's I |
p.values |
the corresponding P-values |
labels |
the names of each level |
or an object of class correlogramList containing a list of
objects of class correlogram if several variables are given as
response in formula.
Julien Dutheil [email protected] and Emmanuel Paradis
data(carnivora) ### Using the formula interface: co <- correlogram.formula(SW ~ Order/SuperFamily/Family/Genus, data=carnivora) co plot(co) ### Several correlograms on the same plot: cos <- correlogram.formula(SW + FW ~ Order/SuperFamily/Family/Genus, data=carnivora) cos plot(cos)data(carnivora) ### Using the formula interface: co <- correlogram.formula(SW ~ Order/SuperFamily/Family/Genus, data=carnivora) co plot(co) ### Several correlograms on the same plot: cos <- correlogram.formula(SW + FW ~ Order/SuperFamily/Family/Genus, data=carnivora) cos plot(cos)
These functions compute the probability density under some birth–death models, that is the probability of obtaining x species after a time t giving how speciation and extinction probabilities vary through time (these may be constant, or even equal to zero for extinction).
dyule(x, lambda = 0.1, t = 1, log = FALSE) dbd(x, lambda, mu, t, conditional = FALSE, log = FALSE) dbdTime(x, birth, death, t, conditional = FALSE, BIRTH = NULL, DEATH = NULL, fast = FALSE)dyule(x, lambda = 0.1, t = 1, log = FALSE) dbd(x, lambda, mu, t, conditional = FALSE, log = FALSE) dbdTime(x, birth, death, t, conditional = FALSE, BIRTH = NULL, DEATH = NULL, fast = FALSE)
x |
a numeric vector of species numbers (see Details). |
lambda |
a numerical value giving the probability of speciation;
can be a vector with several values for |
mu |
id. for extinction. |
t |
id. for the time(s). |
log |
a logical value specifying whether the probabilities should
be returned log-transformed; the default is |
conditional |
a logical specifying whether the probabilities
should be computed conditional under the assumption of no extinction
after time |
birth, death
|
a (vectorized) function specifying how the
speciation or extinction probability changes through time (see
|
BIRTH, DEATH
|
a (vectorized) function giving the primitive
of |
fast |
a logical value specifying whether to use faster
integration (see |
These three functions compute the probabilities to observe x
species starting from a single one after time t (assumed to be
continuous). The first function is a short-cut for the second one with
mu = 0 and with default values for the two other arguments.
dbdTime is for time-varying lambda and mu
specified as R functions.
dyule is vectorized simultaneously on its three arguments
x, lambda, and t, according to R's rules of
recycling arguments. dbd is vectorized simultaneously x
and t (to make likelihood calculations easy), and
dbdTime is vectorized only on x; the other arguments are
eventually shortened with a warning if necessary.
The returned value is, logically, zero for values of x out of
range, i.e., negative or zero for dyule or if conditional
= TRUE. However, it is not checked if the values of x are
positive non-integers and the probabilities are computed and returned.
The details on the form of the arguments birth, death,
BIRTH, DEATH, and fast can be found in the links
below.
a numeric vector.
If you use these functions to calculate a likelihood function, it is
strongly recommended to compute the log-likelihood with, for instance
in the case of a Yule process, sum(dyule( , log = TRUE)) (see
examples).
Emmanuel Paradis
Kendall, D. G. (1948) On the generalized “birth-and-death” process. Annals of Mathematical Statistics, 19, 1–15.
x <- 0:10 plot(x, dyule(x), type = "h", main = "Density of the Yule process") text(7, 0.85, expression(list(lambda == 0.1, t == 1))) y <- dbd(x, 0.1, 0.05, 10) z <- dbd(x, 0.1, 0.05, 10, conditional = TRUE) d <- rbind(y, z) colnames(d) <- x barplot(d, beside = TRUE, ylab = "Density", xlab = "Number of species", legend = c("unconditional", "conditional on\nno extinction"), args.legend = list(bty = "n")) title("Density of the birth-death process") text(17, 0.4, expression(list(lambda == 0.1, mu == 0.05, t == 10))) ## Not run: ### generate 1000 values from a Yule process with lambda = 0.05 x <- replicate(1e3, Ntip(rlineage(0.05, 0))) ### the correct way to calculate the log-likelihood...: sum(dyule(x, 0.05, 50, log = TRUE)) ### ... and the wrong way: log(prod(dyule(x, 0.05, 50))) ### a third, less preferred, way: sum(log(dyule(x, 0.05, 50))) ## End(Not run)x <- 0:10 plot(x, dyule(x), type = "h", main = "Density of the Yule process") text(7, 0.85, expression(list(lambda == 0.1, t == 1))) y <- dbd(x, 0.1, 0.05, 10) z <- dbd(x, 0.1, 0.05, 10, conditional = TRUE) d <- rbind(y, z) colnames(d) <- x barplot(d, beside = TRUE, ylab = "Density", xlab = "Number of species", legend = c("unconditional", "conditional on\nno extinction"), args.legend = list(bty = "n")) title("Density of the birth-death process") text(17, 0.4, expression(list(lambda == 0.1, mu == 0.05, t == 10))) ## Not run: ### generate 1000 values from a Yule process with lambda = 0.05 x <- replicate(1e3, Ntip(rlineage(0.05, 0))) ### the correct way to calculate the log-likelihood...: sum(dyule(x, 0.05, 50, log = TRUE)) ### ... and the wrong way: log(prod(dyule(x, 0.05, 50))) ### a third, less preferred, way: sum(log(dyule(x, 0.05, 50))) ## End(Not run)
This function can be used to define vectors to annotate a set of taxon names, labels, etc. It should facilitate the (re)definition of colours or similar attributes for plotting trees or other graphics.
def(x, ..., default = NULL, regexp = FALSE)def(x, ..., default = NULL, regexp = FALSE)
x |
a vector of mode character. |
... |
a series of statements defining the attributes. |
default |
the default to be used (see details). |
regexp |
a logical value specifying whether the statements
defined in |
The idea of this function is to make the definition of colours, etc., simpler than what is done usually. A typical use is:
def(tr$tip.label, Homo_sapiens = "blue")
which will return a vector of character strings all "black" except one matching the tip label "Homo_sapiens" which will be "blue". Another use could be:
def(tr$tip.label, Homo_sapiens = 2)
which will return a vector a numerical values all 1 except for "Homo_sapiens" which will be 2. Several definitions can be done, e.g.:
def(tr$tip.label, Homo_sapiens = "blue", Pan_paniscus = "red")
The default value is determined with respect to the mode of the values
given with the ... (either "black" or 1).
If regexp = TRUE is used, then the names of the statements must be
quoted, e.g.:
def(tr$tip.label, "^Pan_" = "red", regexp = TRUE)
will return "red" for all labels starting with "Pan_".
a vector of the same length than x.
Emmanuel Paradis
data(bird.orders) a <- def(bird.orders$tip.label, Galliformes = 2) str(a) # numeric plot(bird.orders, font = a) co <- def(bird.orders$tip.label, Passeriformes = "red", Trogoniformes = "blue") str(co) # character plot(bird.orders, tip.color = co) ### use of a regexp (so we need to quote it) to colour all orders ### with names starting with "C" (and change the default): co2 <- def(bird.orders$tip.label, "^C" = "gold", default = "grey", regexp = TRUE) plot(bird.orders, tip.color = co2)data(bird.orders) a <- def(bird.orders$tip.label, Galliformes = 2) str(a) # numeric plot(bird.orders, font = a) co <- def(bird.orders$tip.label, Passeriformes = "red", Trogoniformes = "blue") str(co) # character plot(bird.orders, tip.color = co) ### use of a regexp (so we need to quote it) to colour all orders ### with names starting with "C" (and change the default): co2 <- def(bird.orders$tip.label, "^C" = "gold", default = "grey", regexp = TRUE) plot(bird.orders, tip.color = co2)
degree is a generic function to calculate the degree of all
nodes in a tree or in a network.
degree(x, ...) ## S3 method for class 'phylo' degree(x, details = FALSE, ...) ## S3 method for class 'evonet' degree(x, details = FALSE, ...)degree(x, ...) ## S3 method for class 'phylo' degree(x, details = FALSE, ...) ## S3 method for class 'evonet' degree(x, details = FALSE, ...)
x |
an object (tree, network, ...). |
details |
whether to return the degree of each node in the tree, or a summary table (the default). |
... |
arguments passed to methods. |
The degree of a node (or vertex) in a network is defined by the number of branches (or edges) that connect to this node. In a phylogenetic tree, the tips (or terminal nodes) are of degree one, and the (internal) nodes are of degree two or more.
There are currently two methods for the classes "phylo" and
"evonet". The default of these functions is to return a summary
table with the degrees observed in the tree or network in the first
column, and the number of nodes in the second column. If details
= TRUE, a vector giving the degree of each node (as numbered in the
edge matrix) is returned.
The validity of the object is not checked, so degree can be
used to check problems with badly conformed trees.
a data frame if details = FALSE, or a vector of integers
otherwise.
Emmanuel Paradis
data(bird.orders) degree(bird.orders) degree(bird.orders, details = TRUE) data(bird.families) degree(bird.families) degree(rtree(10)) # 10, 1, 8 degree(rtree(10, rooted = FALSE)) # 10, 0, 8 degree(stree(10)) # 10 + 1 node of degree 10data(bird.orders) degree(bird.orders) degree(bird.orders, details = TRUE) data(bird.families) degree(bird.families) degree(rtree(10)) # 10, 1, 8 degree(rtree(10, rooted = FALSE)) # 10, 0, 8 degree(stree(10)) # 10 + 1 node of degree 10
These functions remove gaps ("-") in a sample of DNA sequences.
del.gaps(x) del.colgapsonly(x, threshold = 1, freq.only = FALSE) del.rowgapsonly(x, threshold = 1, freq.only = FALSE)del.gaps(x) del.colgapsonly(x, threshold = 1, freq.only = FALSE) del.rowgapsonly(x, threshold = 1, freq.only = FALSE)
x |
a matrix, a list, or a vector containing the DNA or AA
sequences; only matrices for |
threshold |
the largest gap proportion to delete the column or row. |
freq.only |
if |
del.gaps remove all gaps, so the returned sequences may not
have all the same lengths and are therefore returned in a list.
del.colgapsonly removes the columns with a proportion at least
threshold of gaps. Thus by default, only the columns with gaps
only are removed (useful when a small matrix is extracted from a large
alignment). del.rowgapsonly does the same for the rows.
The class of the input sequences is respected and kept unchanged,
unless it contains neither "DNAbin" nor "AAbin" in which
case the object is first converted into the class "DNAbin".
del.gaps returns a vector (if there is only one input sequence)
or a list of sequences; del.colgapsonly and
del.rowgapsonly return a matrix of sequences or a numeric
vector (with names for the second function) if freq.only =
TRUE.
Emmanuel Paradis
base.freq, seg.sites,
image.DNAbin, checkAlignment
This function makes a plot following Holland et
al. (2002).
delta.plot(X, k = 20, plot = TRUE, which = 1:2)delta.plot(X, k = 20, plot = TRUE, which = 1:2)
X |
a distance matrix, may be an object of class “dist”. |
k |
an integer giving the number of intervals in the plot. |
plot |
a logical specifying whether to draw the
|
which |
a numeric vector indicating which plots are done; 1: the
histogram of the |
See Holland et al. (2002) for details and interpretation.
The computing time of this function is proportional to the fourth
power of the number of observations (), so calculations
may be very long with only a slight increase in sample size.
This function returns invisibly a named list with two components:
counts: the counts for the histogram of
values
delta.bar: the mean value for each
observation
Emmanuel Paradis
Holland, B. R., Huber, K. T., Dress, A. and Moulton, V. (2002) Delta plots: a tool for analyzing phylogenetic distance data. Molecular Biology and Evolution, 12, 2051–2059.
data(woodmouse) d <- dist.dna(woodmouse) delta.plot(d) layout(1) delta.plot(d, 40, which = 1)data(woodmouse) d <- dist.dna(woodmouse) delta.plot(d) layout(1) delta.plot(d, 40, which = 1)
This function computes a matrix of pairwise distances from DNA sequences using a model of DNA evolution. Eleven substitution models (and the raw distance) are currently available.
dist.dna(x, model = "K80", variance = FALSE, gamma = FALSE, pairwise.deletion = FALSE, base.freq = NULL, as.matrix = FALSE)dist.dna(x, model = "K80", variance = FALSE, gamma = FALSE, pairwise.deletion = FALSE, base.freq = NULL, as.matrix = FALSE)
x |
a matrix or a list containing the DNA sequences; this must be
of class |
model |
a character string specifying the evolutionary model to be
used; must be one of |
variance |
a logical indicating whether to compute the variances
of the distances; defaults to |
gamma |
a value for the gamma parameter possibly used to apply a correction to the distances (by default no correction is applied). |
pairwise.deletion |
a logical indicating whether to delete the
sites with missing data in a pairwise way. The default is to delete
the sites with at least one missing data for all sequences (ignored
if |
base.freq |
the base frequencies to be used in the computations (if applicable). By default, the base frequencies are computed from the whole set of sequences. |
as.matrix |
a logical indicating whether to return the results as a matrix. The default is to return an object of class dist. |
The molecular evolutionary models available through the option
model have been extensively described in the literature. A
brief description is given below; more details can be found in the
references.
raw, N: This is simply the proportion or the number of
sites that differ between each pair of sequences. This may be useful
to draw “saturation plots”. The options variance and
gamma have no effect, but pairwise.deletion may have.
TS, TV: These are the numbers of transitions and
transversions, respectively.
JC69: This model was developed by Jukes and Cantor (1969). It
assumes that all substitutions (i.e. a change of a base by another
one) have the same probability. This probability is the same for all
sites along the DNA sequence. This last assumption can be relaxed by
assuming that the substition rate varies among site following a
gamma distribution which parameter must be given by the user. By
default, no gamma correction is applied. Another assumption is that
the base frequencies are balanced and thus equal to 0.25.
K80: The distance derived by Kimura (1980), sometimes referred
to as “Kimura's 2-parameters distance”, has the same underlying
assumptions than the Jukes–Cantor distance except that two kinds of
substitutions are considered: transitions (A <-> G, C <-> T), and
transversions (A <-> C, A <-> T, C <-> G, G <-> T). They are assumed
to have different probabilities. A transition is the substitution of
a purine (C, T) by another one, or the substitution of a pyrimidine
(A, G) by another one. A transversion is the substitution of a
purine by a pyrimidine, or vice-versa. Both transition and
transversion rates are the same for all sites along the DNA
sequence. Jin and Nei (1990) modified the Kimura model to allow for
variation among sites following a gamma distribution. Like for the
Jukes–Cantor model, the gamma parameter must be given by the
user. By default, no gamma correction is applied.
F81: Felsenstein (1981) generalized the Jukes–Cantor model
by relaxing the assumption of equal base frequencies. The formulae
used in this function were taken from McGuire et al. (1999).
K81: Kimura (1981) generalized his model (Kimura 1980) by
assuming different rates for two kinds of transversions: A <-> C and
G <-> T on one side, and A <-> T and C <-> G on the other. This is
what Kimura called his “three substitution types model” (3ST), and
is sometimes referred to as “Kimura's 3-parameters distance”.
F84: This model generalizes K80 by relaxing the assumption
of equal base frequencies. It was first introduced by Felsenstein in
1984 in Phylip, and is fully described by Felsenstein and Churchill
(1996). The formulae used in this function were taken from McGuire
et al. (1999).
BH87: Barry and Hartigan (1987) developed a distance based
on the observed proportions of changes among the four bases. This
distance is not symmetric.
T92: Tamura (1992) generalized the Kimura model by relaxing
the assumption of equal base frequencies. This is done by taking
into account the bias in G+C content in the sequences. The
substitution rates are assumed to be the same for all sites along
the DNA sequence.
TN93: Tamura and Nei (1993) developed a model which assumes
distinct rates for both kinds of transition (A <-> G versus C <->
T), and transversions. The base frequencies are not assumed to be
equal and are estimated from the data. A gamma correction of the
inter-site variation in substitution rates is possible.
GG95: Galtier and Gouy (1995) introduced a model where the
G+C content may change through time. Different rates are assumed for
transitons and transversions.
logdet: The Log-Det distance, developed by Lockhart et
al. (1994), is related to BH87. However, this distance is
symmetric. Formulae from Gu and Li (1996) are used.
dist.logdet in phangorn uses a different
implementation that gives substantially different distances for
low-diverging sequences.
paralin: Lake (1994) developed the paralinear distance which
can be viewed as another variant of the Barry–Hartigan distance.
indel: this counts the number of sites where there is an
insertion/deletion gap in one sequence and not in the other.
indelblock: same than before but contiguous gaps are
counted as a single unit. Note that the distance between -A- and
A-- is 3 because there are three different blocks of gaps, whereas
the “indel” distance will be 2.
an object of class dist (by default), or a numeric
matrix if as.matrix = TRUE. If model = "BH87", a numeric
matrix is returned because the Barry–Hartigan distance is not
symmetric.
If variance = TRUE an attribute called "variance" is
given to the returned object.
If the sequences are very different, most evolutionary distances are
undefined and a non-finite value (Inf or NaN) is returned. You may do
dist.dna(, model = "raw") to check whether some values are
higher than 0.75.
Emmanuel Paradis
Barry, D. and Hartigan, J. A. (1987) Asynchronous distance between homologous DNA sequences. Biometrics, 43, 261–276.
Felsenstein, J. (1981) Evolutionary trees from DNA sequences: a maximum likelihood approach. Journal of Molecular Evolution, 17, 368–376.
Felsenstein, J. and Churchill, G. A. (1996) A Hidden Markov model approach to variation among sites in rate of evolution. Molecular Biology and Evolution, 13, 93–104.
Galtier, N. and Gouy, M. (1995) Inferring phylogenies from DNA sequences of unequal base compositions. Proceedings of the National Academy of Sciences USA, 92, 11317–11321.
Gu, X. and Li, W.-H. (1996) Bias-corrected paralinear and LogDet distances and tests of molecular clocks and phylogenies under nonstationary nucleotide frequencies. Molecular Biology and Evolution, 13, 1375–1383.
Jukes, T. H. and Cantor, C. R. (1969) Evolution of protein molecules. in Mammalian Protein Metabolism, ed. Munro, H. N., pp. 21–132, New York: Academic Press.
Kimura, M. (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16, 111–120.
Kimura, M. (1981) Estimation of evolutionary distances between homologous nucleotide sequences. Proceedings of the National Academy of Sciences USA, 78, 454–458.
Jin, L. and Nei, M. (1990) Limitations of the evolutionary parsimony method of phylogenetic analysis. Molecular Biology and Evolution, 7, 82–102.
Lake, J. A. (1994) Reconstructing evolutionary trees from DNA and protein sequences: paralinear distances. Proceedings of the National Academy of Sciences USA, 91, 1455–1459.
Lockhart, P. J., Steel, M. A., Hendy, M. D. and Penny, D. (1994) Recovering evolutionary trees under a more realistic model of sequence evolution. Molecular Biology and Evolution, 11, 605–602.
McGuire, G., Prentice, M. J. and Wright, F. (1999). Improved error bounds for genetic distances from DNA sequences. Biometrics, 55, 1064–1070.
Tamura, K. (1992) Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G + C-content biases. Molecular Biology and Evolution, 9, 678–687.
Tamura, K. and Nei, M. (1993) Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution, 10, 512–526.
read.GenBank, read.dna,
write.dna, DNAbin,
dist.gene, cophenetic.phylo,
dist
This function computes a matrix of distances between pairs of individuals from a matrix or a data frame of genetic data.
dist.gene(x, method = "pairwise", pairwise.deletion = FALSE, variance = FALSE)dist.gene(x, method = "pairwise", pairwise.deletion = FALSE, variance = FALSE)
x |
a matrix or a data frame (will be coerced as a matrix). |
method |
a character string specifying the method used to compute
the distances; two choices are available: |
pairwise.deletion |
a logical indicating whether to delete the columns with missing data on a pairwise basis. The default is to delete the columns with at least one missing observation. |
variance |
a logical, indicates whether the variance of the
distances should be returned (default to |
This function is meant to be very general and accepts different kinds of data (alleles, haplotypes, SNP, DNA sequences, ...). The rows of the data matrix represent the individuals, and the columns the loci.
In the case of the pairwise method, the distance between two
individuals is the number of loci for which they differ, and the
associated variance is , where is the number
of loci.
In the case of the percentage method, this distance is divided by ,
and the associated variance is .
For more elaborate distances with DNA sequences, see the function
dist.dna.
an object of class dist. If variance = TRUE an
attribute called "variance" is given to the returned object.
Missing data (NA) are coded and treated in R's usual way.
Emmanuel Paradis
dist.dna, cophenetic.phylo,
dist
This function computes the topological distance between two
phylogenetic trees or among trees in a list (if y = NULL using
different methods.
dist.topo(x, y = NULL, method = "PH85", mc.cores = 1)dist.topo(x, y = NULL, method = "PH85", mc.cores = 1)
x |
an object of class |
y |
an (optional) object of class |
method |
a character string giving the method to be used: either
|
mc.cores |
the number of cores (CPUs) to be used (passed to parallel). |
Two methods are available: the one by Penny and Hendy (1985, originally from Robinson and Foulds 1981), and the branch length score by Kuhner and Felsenstein (1994). The trees are always considered as unrooted.
The topological distance is defined as twice the number of internal branches defining different bipartitions of the tips (Robinson and Foulds 1981; Penny and Hendy 1985). Rzhetsky and Nei (1992) proposed a modification of the original formula to take multifurcations into account.
The branch length score may be seen as similar to the previous distance but taking branch lengths into account. Kuhner and Felsenstein (1994) proposed to calculate the square root of the sum of the squared differences of the (internal) branch lengths defining similar bipartitions (or splits) in both trees.
a single numeric value if both x and y are used, an
object of class "dist" otherwise.
Emmanuel Paradis
Billera, L. J., Holmes, S. P. and Vogtmann, K. (2001) Geometry of the space of phylogenetic trees. Advances in Applied Mathematics, 27, 733–767.
Kuhner, M. K. and Felsenstein, J. (1994) Simulation comparison of phylogeny algorithms under equal and unequal evolutionary rates. Molecular Biology and Evolution, 11, 459–468.
Nei, M. and Kumar, S. (2000) Molecular Evolution and Phylogenetics. Oxford: Oxford University Press.
Penny, D. and Hendy, M. D. (1985) The use of tree comparison metrics. Systemetic Zoology, 34, 75–82.
Robinson, D. F. and Foulds, L. R. (1981) Comparison of phylogenetic trees. Mathematical Biosciences, 53, 131–147.
Rzhetsky, A. and Nei, M. (1992) A simple method for estimating and testing minimum-evolution trees. Molecular Biology and Evolution, 9, 945–967.
The package phangorn has several methods for tree distances (see
?treedist).
The geodesic distance of Billera et al. (2001) is implemented in the package distory.
ta <- rtree(30, rooted = FALSE) tb <- rtree(30, rooted = FALSE) dist.topo(ta, ta) # 0 dist.topo(ta, tb) # unlikely to be 0 ## rmtopology() simulated unrooted trees by default: TR <- rmtopology(100, 10) ## these trees have 7 internal branches, so the maximum distance ## between two of them is 14: DTR <- dist.topo(TR) table(DTR)ta <- rtree(30, rooted = FALSE) tb <- rtree(30, rooted = FALSE) dist.topo(ta, ta) # 0 dist.topo(ta, tb) # unlikely to be 0 ## rmtopology() simulated unrooted trees by default: TR <- rmtopology(100, 10) ## these trees have 7 internal branches, so the maximum distance ## between two of them is 14: DTR <- dist.topo(TR) table(DTR)
This function computes two tests of the distribution of branching
times using the Cramér–von Mises and Anderson–Darling
goodness-of-fit tests. By default, it is assumed that the
diversification rate is constant, and an exponential distribution is
assumed for the branching times. In this case, the expected
distribution under this model is computed with a rate estimated from
the data. Alternatively, the user may specify an expected cumulative
density function (z): in this case, x and z must
be of the same length. See the examples for how to compute the latter
from a sample of expected branching times.
diversi.gof(x, null = "exponential", z = NULL)diversi.gof(x, null = "exponential", z = NULL)
x |
a numeric vector with the branching times. |
null |
a character string specifying the null distribution for
the branching times. Only two choices are possible: either
|
z |
used if |
The Cramér–von Mises and Anderson–Darling tests compare the empirical density function (EDF) of the observations to an expected cumulative density function. By contrast to the Kolmogorov–Smirnov test where the greatest difference between these two functions is used, in both tests all differences are taken into account.
The distributions of both test statistics depend on the null hypothesis, and on whether or not some parameters were estimated from the data. However, these distributions are not known precisely and critical values were determined by Stephens (1974) using simulations. These critical values were used for the present function.
NULL (the results are simply printed).
Emmanuel Paradis
Paradis, E. (1998) Testing for constant diversification rates using molecular phylogenies: a general approach based on statistical tests for goodness of fit. Molecular Biology and Evolution, 15, 476–479.
Stephens, M. A. (1974) EDF statistics for goodness of fit and some comparisons. Journal of the American Statistical Association, 69, 730–737.
branching.times, diversi.time
ltt.plot, birthdeath, yule,
yule.cov
data(bird.families) x <- branching.times(bird.families) ### suppose we have a sample of expected branching times `y'; ### for simplicity, take them from a uniform distribution: y <- runif(500, 0, max(x) + 1) # + 1 to avoid A2 = Inf ### now compute the expected cumulative distribution: x <- sort(x) N <- length(x) ecdf <- numeric(N) for (i in 1:N) ecdf[i] <- sum(y <= x[i])/500 ### finally do the test: diversi.gof(x, "user", z = ecdf)data(bird.families) x <- branching.times(bird.families) ### suppose we have a sample of expected branching times `y'; ### for simplicity, take them from a uniform distribution: y <- runif(500, 0, max(x) + 1) # + 1 to avoid A2 = Inf ### now compute the expected cumulative distribution: x <- sort(x) N <- length(x) ecdf <- numeric(N) for (i in 1:N) ecdf[i] <- sum(y <= x[i])/500 ### finally do the test: diversi.gof(x, "user", z = ecdf)
This functions fits survival models to a set of branching times, some of them may be known approximately (censored). Three models are fitted, Model A assuming constant diversification, Model B assuming that diversification follows a Weibull law, and Model C assuming that diversification changes with a breakpoint at time ‘Tc’. The models are fitted by maximum likelihood.
diversi.time(x, census = NULL, censoring.codes = c(1, 0), Tc = NULL)diversi.time(x, census = NULL, censoring.codes = c(1, 0), Tc = NULL)
x |
a numeric vector with the branching times. |
census |
a vector of the same length than ‘x’ used as an indicator variable; thus, it must have only two values, one coding for accurately known branching times, and the other for censored branching times. This argument can be of any mode (numeric, character, logical), or can even be a factor. |
censoring.codes |
a vector of length two giving the codes used
for |
Tc |
a single numeric value specifying the break-point time to fit Model C. If none is provided, then it is set arbitrarily to the mean of the analysed branching times. |
The principle of the method is to consider each branching time as an event: if the branching time is accurately known, then it is a failure event; if it is approximately knwon then it is a censoring event. An analogy is thus made between the failure (or hazard) rate estimated by the survival models and the diversification rate of the lineage. Time is here considered from present to past.
Model B assumes a monotonically changing diversification rate. The parameter that controls the change of this rate is called beta. If beta is greater than one, then the diversification rate decreases through time; if it is lesser than one, the the rate increases through time. If beta is equal to one, then Model B reduces to Model A.
NULL (the results are simply printed).
Emmanuel Paradis
Paradis, E. (1997) Assessing temporal variations in diversification rates from phylogenies: estimation and hypothesis testing. Proceedings of the Royal Society of London. Series B. Biological Sciences, 264, 1141–1147.
branching.times, diversi.gof
ltt.plot, birthdeath,
bd.ext, yule, yule.cov
This function performs the diversity contrast test comparing pairs of sister-clades.
diversity.contrast.test(x, method = "ratiolog", alternative = "two.sided", nrep = 0, ...)diversity.contrast.test(x, method = "ratiolog", alternative = "two.sided", nrep = 0, ...)
x |
a matrix or a data frame with at least two columns: the first one gives the number of species in clades with a trait supposed to increase or decrease diversification rate, and the second one the number of species in the sister-clades without the trait. Each row represents a pair of sister-clades. |
method |
a character string specifying the kind of test:
|
alternative |
a character string defining the alternative
hypothesis: |
nrep |
the number of replications of the randomization test; by default, a Wilcoxon test is done. |
... |
arguments passed to the function
|
If method = "ratiolog", the test described in Barraclough et
al. (1996) is performed. If method = "proportion", the version
in Barraclough et al. (1995) is used. If method = "difference",
the signed difference is used (Sargent 2004). If method = "logratio",
then this is Wiegmann et al.'s (1993) version. These
four tests are essentially different versions of the same test (Vamosi
and Vamosi 2005, Vamosi 2007). See Paradis (2012) for a comparison of
their statistical performance with other tests.
If nrep = 0, a Wilcoxon test is done on the species diversity
contrasts with the null hypothesis is that they are distributed around
zero. If nrep > 0, a randomization procedure is done where the
signs of the diversity contrasts are randomly chosen. This is used to
create a distribution of the test statistic which is compared with the
observed value (the sum of the diversity contrasts).
a single numeric value with the P-value.
Emmanuel Paradis
Barraclough, T. G., Harvey, P. H. and Nee, S. (1995) Sexual selection and taxonomic diversity in passerine birds. Proceedings of the Royal Society of London. Series B. Biological Sciences, 259, 211–215.
Barraclough, T. G., Harvey, P. H., and Nee, S. (1996) Rate of rbcL gene sequence evolution and species diversification in flowering plants (angiosperms). Proceedings of the Royal Society of London. Series B. Biological Sciences, 263, 589–591.
Paradis, E. (2012) Shift in diversification in sister-clade comparisons: a more powerful test. Evolution, 66, 288–295.
Sargent, R. D. (2004) Floral symmetry affects speciation rates in angiosperms. Proceedings of the Royal Society of London. Series B. Biological Sciences, 271, 603–608.
Vamosi, S. M. (2007) Endless tests: guidelines for analysing non-nested sister-group comparisons. An addendum. Evolutionary Ecology Research, 9, 717.
Vamosi, S. M. and Vamosi, J. C. (2005) Endless tests: guidelines for analysing non-nested sister-group comparisons. Evolutionary Ecology Research, 7, 567–579.
Wiegmann, B., Mitter, C. and Farrell, B. 1993. Diversification of carnivorous parasitic insects: extraordinary radiation or specialized dead end? American Naturalist, 142, 737–754.
slowinskiguyer.test, mcconwaysims.test
richness.yule.test
### data from Vamosi & Vamosi (2005): fleshy <- c(1, 1, 1, 1, 1, 3, 3, 5, 9, 16, 33, 40, 50, 100, 216, 393, 850, 947,1700) dry <- c(2, 64, 300, 89, 67, 4, 34, 10, 150, 35, 2, 60, 81, 1, 3, 1, 11, 1, 18) x <- cbind(fleshy, dry) diversity.contrast.test(x) diversity.contrast.test(x, alt = "g") diversity.contrast.test(x, alt = "g", nrep = 1e4) slowinskiguyer.test(x) mcconwaysims.test(x)### data from Vamosi & Vamosi (2005): fleshy <- c(1, 1, 1, 1, 1, 3, 3, 5, 9, 16, 33, 40, 50, 100, 216, 393, 850, 947,1700) dry <- c(2, 64, 300, 89, 67, 4, 34, 10, 150, 35, 2, 60, 81, 1, 3, 1, 11, 1, 18) x <- cbind(fleshy, dry) diversity.contrast.test(x) diversity.contrast.test(x, alt = "g") diversity.contrast.test(x, alt = "g", nrep = 1e4) slowinskiguyer.test(x) mcconwaysims.test(x)
These functions help to manipulate DNA sequences.
## S3 method for class 'DNAbin' print(x, printlen = 6, digits = 3, ...) ## S3 method for class 'DNAbin' rbind(...) ## S3 method for class 'DNAbin' cbind(..., check.names = TRUE, fill.with.gaps = FALSE, quiet = FALSE) ## S3 method for class 'DNAbin' x[i, j, drop = FALSE] ## S3 method for class 'DNAbin' as.matrix(x, ...) ## S3 method for class 'DNAbin' c(..., recursive = FALSE) ## S3 method for class 'DNAbin' as.list(x, ...) ## S3 method for class 'DNAbin' labels(object, ...)## S3 method for class 'DNAbin' print(x, printlen = 6, digits = 3, ...) ## S3 method for class 'DNAbin' rbind(...) ## S3 method for class 'DNAbin' cbind(..., check.names = TRUE, fill.with.gaps = FALSE, quiet = FALSE) ## S3 method for class 'DNAbin' x[i, j, drop = FALSE] ## S3 method for class 'DNAbin' as.matrix(x, ...) ## S3 method for class 'DNAbin' c(..., recursive = FALSE) ## S3 method for class 'DNAbin' as.list(x, ...) ## S3 method for class 'DNAbin' labels(object, ...)
x, object
|
an object of class |
... |
either further arguments to be passed to or from other
methods in the case of |
printlen |
the number of labels to print (6 by default). |
digits |
the number of digits to print (3 by default). |
check.names |
a logical specifying whether to check the rownames before binding the columns (see details). |
fill.with.gaps |
a logical indicating whether to keep all
possible individuals as indicating by the rownames, and eventually
filling the missing data with insertion gaps (ignored if
|
quiet |
a logical to switch off warning messages when some rows are dropped. |
i, j
|
indices of the rows and/or columns to select or to drop. They may be numeric, logical, or character (in the same way than for standard R objects). |
drop |
logical; if |
recursive |
for compatibility with the generic (unused). |
These are all ‘methods’ of generic functions which are here applied to
DNA sequences stored as objects of class "DNAbin". They are
used in the same way than the standard R functions to manipulate
vectors, matrices, and lists. Additionally, the operators [[
and $ may be used to extract a vector from a list. Note that
the default of drop is not the same than the generic operator:
this is to avoid dropping rownames when selecting a single sequence.
These functions are provided to manipulate easily DNA sequences coded with the bit-level coding scheme. The latter allows much faster comparisons of sequences, as well as storing them in less memory compared to the format used before ape 1.10.
For cbind, the default behaviour is to keep only individuals
(as indicated by the rownames) for which there are no missing data. If
fill.with.gaps = TRUE, a ‘complete’ matrix is returned,
enventually with insertion gaps as missing data. If check.names
= TRUE (the default), the rownames of each matrix are checked, and
the rows are reordered if necessary (if some rownames are duplicated,
an error is returned). If check.names = FALSE, the matrices
must all have the same number of rows, and are simply binded; the
rownames of the first matrix are used. See the examples.
as.matrix may be used to convert DNA sequences (of the same
length) stored in a list into a matrix while keeping the names and the
class. as.list does the reverse operation.
an object of class "DNAbin" in the case of rbind,
cbind, and [.
Emmanuel Paradis
Paradis, E. (2007) A Bit-Level Coding Scheme for Nucleotides. https://emmanuelparadis.github.io/misc/BitLevelCodingScheme_20April2007.pdf
Paradis, E. (2012) Analysis of Phylogenetics and Evolution with R (Second Edition). New York: Springer.
as.DNAbin, read.dna,
read.GenBank, write.dna,
image.DNAbin,AAbin
The corresponding generic functions are documented in the package base.
data(woodmouse) woodmouse print(woodmouse, 15, 6) print(woodmouse[1:5, 1:300], 15, 6) ### Just to show how distances could be influenced by sampling: dist.dna(woodmouse[1:2, ]) dist.dna(woodmouse[1:3, ]) ### cbind and its options: x <- woodmouse[1:2, 1:5] y <- woodmouse[2:4, 6:10] as.character(cbind(x, y)) # gives warning as.character(cbind(x, y, fill.with.gaps = TRUE)) ## Not run: as.character(cbind(x, y, check.names = FALSE)) # gives an error ## End(Not run)data(woodmouse) woodmouse print(woodmouse, 15, 6) print(woodmouse[1:5, 1:300], 15, 6) ### Just to show how distances could be influenced by sampling: dist.dna(woodmouse[1:2, ]) dist.dna(woodmouse[1:3, ]) ### cbind and its options: x <- woodmouse[1:2, 1:5] y <- woodmouse[2:4, 6:10] as.character(cbind(x, y)) # gives warning as.character(cbind(x, y, fill.with.gaps = TRUE)) ## Not run: as.character(cbind(x, y, check.names = FALSE)) # gives an error ## End(Not run)
This function scans a set of aligned DNA sequences and returns a matrix with information of the localisations and lengths on alignment gaps.
DNAbin2indel(x)DNAbin2indel(x)
x |
an object of class |
The output matrix has the same dimensions than the input one with, either a numeric value where an alignment gap starts giving the length of the gap, or zero. The rownames are kept in the output.
a numeric matrix.
Emmanuel Paradis
DNAbin, as.DNAbin, del.gaps,
seg.sites, image.DNAbin,
checkAlignment
This function computes the pairwise ratios dN/dS for a set of aligned DNA sequences using Li's (1993) method.
dnds(x, code = 1, codonstart = 1, quiet = FALSE, details = FALSE, return.categories = FALSE)dnds(x, code = 1, codonstart = 1, quiet = FALSE, details = FALSE, return.categories = FALSE)
x |
an object of class |
code |
an integer value giving the genetic code to be used. Currently, the codes 1 to 6 are supported. |
codonstart |
an integer giving where to start the translation. This should be 1, 2, or 3, but larger values are accepted and have for effect to start the translation further within the sequence. |
quiet |
single logical value: whether to indicate progress of calculations. |
details |
single logical value (see details). |
return.categories |
a logical value: if |
Since ape 5.6, the degeneracy of each codon is calculated
directly from the genetic code using the function
trans. A consequence is that ambiguous bases are ignored
(see solveAmbiguousBases).
If details = TRUE, a table is printed for each pair of
sequences giving the numbers of transitions and transversions for each
category of degeneracy (nondegenerate, twofold, and fourfold). This is
helpful when non-meaningful values are returned (e.g., NaN, Inf,
negative values).
an object of class "dist", or a numeric matrix if
return.categories = TRUE.
Emmanuel Paradis
Li, W.-H. (1993) Unbiased estimation of the rates of synonymous and nonsynonymous substitution. Journal of Molecular Evolution, 36, 96–99.
AAbin, trans, alview,
solveAmbiguousBases
data(woodmouse) res <- dnds(woodmouse, quiet = TRUE) # NOT correct res2 <- dnds(woodmouse, code = 2, quiet = TRUE) # using the correct code identical(res, res2) # FALSE... cor(res, res2) # ... but very close ## There a few N's in the woodmouse data, but this does not affect ## greatly the results: res3 <- dnds(solveAmbiguousBases(woodmouse), code = 2, quiet = TRUE) cor(res, res3) ## a simple example showing the usefulness of 'details = TRUE' X <- as.DNAbin(matrix(c("C", "A", "G", "G", "T", "T"), 2, 3)) alview(X) dnds(X, quiet = TRUE) # NaN dnds(X, details = TRUE) # only a TV at a nondegenerate sitedata(woodmouse) res <- dnds(woodmouse, quiet = TRUE) # NOT correct res2 <- dnds(woodmouse, code = 2, quiet = TRUE) # using the correct code identical(res, res2) # FALSE... cor(res, res2) # ... but very close ## There a few N's in the woodmouse data, but this does not affect ## greatly the results: res3 <- dnds(solveAmbiguousBases(woodmouse), code = 2, quiet = TRUE) cor(res, res3) ## a simple example showing the usefulness of 'details = TRUE' X <- as.DNAbin(matrix(c("C", "A", "G", "G", "T", "T"), 2, 3)) alview(X) dnds(X, quiet = TRUE) # NaN dnds(X, details = TRUE) # only a TV at a nondegenerate site
drop.tip removes the terminal branches of a phylogenetic tree,
possibly removing the corresponding internal branches. keep.tip
does the opposite operation (i.e., returns the induced tree).
extract.clade does the inverse operation: it keeps all the tips
from a given node, and deletes all the other tips.
drop.tip(phy, tip, ...) ## S3 method for class 'phylo' drop.tip(phy, tip, trim.internal = TRUE, subtree = FALSE, root.edge = 0, rooted = is.rooted(phy), collapse.singles = TRUE, interactive = FALSE, ...) ## S3 method for class 'multiPhylo' drop.tip(phy, tip, ...) keep.tip(phy, tip, ...) ## S3 method for class 'phylo' keep.tip(phy, tip, ...) ## S3 method for class 'multiPhylo' keep.tip(phy, tip, ...) extract.clade(phy, node, root.edge = 0, collapse.singles = TRUE, interactive = FALSE)drop.tip(phy, tip, ...) ## S3 method for class 'phylo' drop.tip(phy, tip, trim.internal = TRUE, subtree = FALSE, root.edge = 0, rooted = is.rooted(phy), collapse.singles = TRUE, interactive = FALSE, ...) ## S3 method for class 'multiPhylo' drop.tip(phy, tip, ...) keep.tip(phy, tip, ...) ## S3 method for class 'phylo' keep.tip(phy, tip, ...) ## S3 method for class 'multiPhylo' keep.tip(phy, tip, ...) extract.clade(phy, node, root.edge = 0, collapse.singles = TRUE, interactive = FALSE)
phy |
an object of class |
tip |
a vector of mode numeric or character specifying the tips to delete. |
trim.internal |
a logical specifying whether to delete the corresponding internal branches. |
subtree |
a logical specifying whether to output in the tree how many tips have been deleted and where. |
root.edge |
an integer giving the number of internal branches to
be used to build the new root edge. This has no effect if
|
rooted |
a logical indicating whether the tree must be treated as rooted or not. This allows to force the tree to be considered as unrooted (see examples). See details about a possible root.edge element in the tree. |
collapse.singles |
a logical specifying whether to delete the internal nodes of degree 2. |
node |
a node number or label. |
interactive |
if |
... |
arguments passed from and to methods. |
The argument tip can be either character or numeric. In the
first case, it gives the labels of the tips to be deleted; in the
second case the numbers of these labels in the vector
phy$tip.label are given.
This also applies to node, but if this argument is character
and the tree has no node label, this results in an error. If more than
one value is given with node (i.e., a vector of length two or
more), only the first one is used with a warning.
If trim.internal = FALSE, the new tips are given "NA" as
labels, unless there are node labels in the tree in which case they
are used.
If subtree = TRUE, the returned tree has one or several
terminal branches named with node labels if available. Otherwise it is
indicated how many tips have been removed (with a label "[x_tips]").
This is done for as many monophyletic groups that have been deleted.
Note that subtree = TRUE implies trim.internal = TRUE.
To undestand how the option root.edge works, see the examples
below. If rooted = FALSE and the tree has a root edge, the
latter is removed in the output.
an object of class "phylo".
Emmanuel Paradis, Klaus Schliep, Joseph Brown
data(bird.families) tip <- c( "Eopsaltriidae", "Acanthisittidae", "Pittidae", "Eurylaimidae", "Philepittidae", "Tyrannidae", "Thamnophilidae", "Furnariidae", "Formicariidae", "Conopophagidae", "Rhinocryptidae", "Climacteridae", "Menuridae", "Ptilonorhynchidae", "Maluridae", "Meliphagidae", "Pardalotidae", "Petroicidae", "Irenidae", "Orthonychidae", "Pomatostomidae", "Laniidae", "Vireonidae", "Corvidae", "Callaeatidae", "Picathartidae", "Bombycillidae", "Cinclidae", "Muscicapidae", "Sturnidae", "Sittidae", "Certhiidae", "Paridae", "Aegithalidae", "Hirundinidae", "Regulidae", "Pycnonotidae", "Hypocoliidae", "Cisticolidae", "Zosteropidae", "Sylviidae", "Alaudidae", "Nectariniidae", "Melanocharitidae", "Paramythiidae","Passeridae", "Fringillidae") plot(drop.tip(bird.families, tip)) plot(drop.tip(bird.families, tip, trim.internal = FALSE)) data(bird.orders) plot(drop.tip(bird.orders, 6:23, subtree = TRUE)) plot(drop.tip(bird.orders, c(1:5, 20:23), subtree = TRUE)) plot(drop.tip(bird.orders, c(1:20, 23), subtree = TRUE)) plot(drop.tip(bird.orders, c(1:20, 23), subtree = TRUE, rooted = FALSE)) ### Examples of the use of `root.edge' tr <- read.tree(text = "(A:1,(B:1,(C:1,(D:1,E:1):1):1):1):1;") drop.tip(tr, c("A", "B"), root.edge = 0) # = (C:1,(D:1,E:1):1); drop.tip(tr, c("A", "B"), root.edge = 1) # = (C:1,(D:1,E:1):1):1; drop.tip(tr, c("A", "B"), root.edge = 2) # = (C:1,(D:1,E:1):1):2; drop.tip(tr, c("A", "B"), root.edge = 3) # = (C:1,(D:1,E:1):1):3;data(bird.families) tip <- c( "Eopsaltriidae", "Acanthisittidae", "Pittidae", "Eurylaimidae", "Philepittidae", "Tyrannidae", "Thamnophilidae", "Furnariidae", "Formicariidae", "Conopophagidae", "Rhinocryptidae", "Climacteridae", "Menuridae", "Ptilonorhynchidae", "Maluridae", "Meliphagidae", "Pardalotidae", "Petroicidae", "Irenidae", "Orthonychidae", "Pomatostomidae", "Laniidae", "Vireonidae", "Corvidae", "Callaeatidae", "Picathartidae", "Bombycillidae", "Cinclidae", "Muscicapidae", "Sturnidae", "Sittidae", "Certhiidae", "Paridae", "Aegithalidae", "Hirundinidae", "Regulidae", "Pycnonotidae", "Hypocoliidae", "Cisticolidae", "Zosteropidae", "Sylviidae", "Alaudidae", "Nectariniidae", "Melanocharitidae", "Paramythiidae","Passeridae", "Fringillidae") plot(drop.tip(bird.families, tip)) plot(drop.tip(bird.families, tip, trim.internal = FALSE)) data(bird.orders) plot(drop.tip(bird.orders, 6:23, subtree = TRUE)) plot(drop.tip(bird.orders, c(1:5, 20:23), subtree = TRUE)) plot(drop.tip(bird.orders, c(1:20, 23), subtree = TRUE)) plot(drop.tip(bird.orders, c(1:20, 23), subtree = TRUE, rooted = FALSE)) ### Examples of the use of `root.edge' tr <- read.tree(text = "(A:1,(B:1,(C:1,(D:1,E:1):1):1):1):1;") drop.tip(tr, c("A", "B"), root.edge = 0) # = (C:1,(D:1,E:1):1); drop.tip(tr, c("A", "B"), root.edge = 1) # = (C:1,(D:1,E:1):1):1; drop.tip(tr, c("A", "B"), root.edge = 2) # = (C:1,(D:1,E:1):1):2; drop.tip(tr, c("A", "B"), root.edge = 3) # = (C:1,(D:1,E:1):1):3;
edges draws edges on a plotted tree. fancyarrows
enhances arrows with triangle and harpoon
heads; it can be called from edges.
edges(nodes0, nodes1, arrows = 0, type = "classical", ...) fancyarrows(x0, y0, x1, y1, length = 0.25, angle = 30, code = 2, col = par("fg"), lty = par("lty"), lwd = par("lwd"), type = "triangle", ...)edges(nodes0, nodes1, arrows = 0, type = "classical", ...) fancyarrows(x0, y0, x1, y1, length = 0.25, angle = 30, code = 2, col = par("fg"), lty = par("lty"), lwd = par("lwd"), type = "triangle", ...)
nodes0, nodes1
|
vectors of integers giving the tip and/or node numbers where to start and to end the edges (eventually recycled). |
arrows |
an integer between 0 and 3; 0: lines (the default); 1:
an arrow head is drawn at |
type |
if the previous argument is not 0, the type of arrow head:
|
x0, y0, x1, y1
|
the coordinates of the start and end points for
|
length, angle, code, col, lty, lwd
|
default options similar to
those of |
... |
further arguments passed to |
The first function is helpful when drawing reticulations on a phylogeny, especially if computed from the edge matrix.
fancyarrows does not work with log-transformed scale(s).
Emmanuel Paradis
set.seed(2) tr <- rcoal(6) plot(tr, "c") edges(10, 9, col = "red", lty = 2) edges(10:11, 8, col = c("blue", "green")) # recycling of 'nodes1' edges(1, 2, lwd = 2, type = "h", arrows = 3, col = "green") nodelabels()set.seed(2) tr <- rcoal(6) plot(tr, "c") edges(10, 9, col = "red", lty = 2) edges(10:11, 8, col = c("blue", "green")) # recycling of 'nodes1' edges(1, 2, lwd = 2, type = "h", arrows = 3, col = "green") nodelabels()
evonet builds a network from a tree of class
"phylo". There are print, plot, and
reorder methods as well as a few conversion functions.
evonet(phy, from, to = NULL) ## S3 method for class 'evonet' print(x, ...) ## S3 method for class 'evonet' plot(x, col = "blue", lty = 1, lwd = 1, alpha = 0.5, arrows = 0, arrow.type = "classical", node.depth = 2, ...) ## S3 method for class 'evonet' Nedge(phy) ## S3 method for class 'evonet' reorder(x, order = "cladewise", index.only = FALSE, ...) ## S3 method for class 'evonet' as.phylo(x, ...) ## S3 method for class 'evonet' as.networx(x, weight = NA, ...) ## S3 method for class 'evonet' as.network(x, directed = TRUE, ...) ## S3 method for class 'evonet' as.igraph(x, directed = TRUE, use.labels = TRUE, ...) as.evonet(x, ...) ## S3 method for class 'phylo' as.evonet(x, ...) ## S3 method for class 'multiPhylo' as.evonet(x, ...) read.evonet(file = "", text = NULL, comment.char = "", ...) write.evonet(x, file = "", ...)evonet(phy, from, to = NULL) ## S3 method for class 'evonet' print(x, ...) ## S3 method for class 'evonet' plot(x, col = "blue", lty = 1, lwd = 1, alpha = 0.5, arrows = 0, arrow.type = "classical", node.depth = 2, ...) ## S3 method for class 'evonet' Nedge(phy) ## S3 method for class 'evonet' reorder(x, order = "cladewise", index.only = FALSE, ...) ## S3 method for class 'evonet' as.phylo(x, ...) ## S3 method for class 'evonet' as.networx(x, weight = NA, ...) ## S3 method for class 'evonet' as.network(x, directed = TRUE, ...) ## S3 method for class 'evonet' as.igraph(x, directed = TRUE, use.labels = TRUE, ...) as.evonet(x, ...) ## S3 method for class 'phylo' as.evonet(x, ...) ## S3 method for class 'multiPhylo' as.evonet(x, ...) read.evonet(file = "", text = NULL, comment.char = "", ...) write.evonet(x, file = "", ...)
phy |
an object of class |
x |
an object of class |
from |
a vector (or a matrix if |
to |
a vector of the same length than |
col, lty, lwd, node.depth
|
colors, line type and width of the
reticulations (recycled if necessary). These are passed to
|
alpha |
a value between 0 and 1 specifying the transparency of the reticulations. |
arrows, arrow.type
|
see |
order, index.only
|
see |
weight |
a numeric vector giving the weights for the
reticulations when converting to the class |
directed |
a logical: should the network be considered as
directed? |
use.labels |
a logical specifying whether to use the tip and node
labels when building the network of class |
file, text, comment.char
|
see |
... |
arguments passed to other methods. |
evonet is a constructor function that checks the arguments.
The classes "networx", "network", and "igraph"
are defined in the packages phangorn, network, and
igraph, respectively.
read.evonet reads networks from files in extended newick format
(Cardona et al. 2008).
an object of class c("evonet", "phylo") which is made of an
object of class "phylo" plus an element
reticulation coding additional edges among nodes and uses the
same coding rules than the edge matrix.
The conversion functions return an object of the appropriate class.
Emmanuel Paradis, Klaus Schliep
Cardona, G., Rossell, F., and Valiente, G. (2008) Extended Newick: it is time for a standard representation of phylogenetic networks. BMC Bioinformatics, 9, 532.
as.networx in package phangorn
tr <- rcoal(5) (x <- evonet(tr, 6:7, 8:9)) plot(x) ## simple example of extended Newick format: (enet <- read.evonet(text = "((a:2,(b:1)#H1:1):1,(#H1,c:1):2);")) plot(enet, arrows=1) ## from Fig. 2 in Cardona et al. 2008: z <- read.evonet(text = "((1,((2,(3,(4)Y#H1)g)e,(((Y#H1, 5)h,6)f)X#H2)c)a,((X#H2,7)d,8)b)r;") z plot(z) ## Not run: if (require(igraph)) { plot(as.igraph(z)) } ## End(Not run)tr <- rcoal(5) (x <- evonet(tr, 6:7, 8:9)) plot(x) ## simple example of extended Newick format: (enet <- read.evonet(text = "((a:2,(b:1)#H1:1):1,(#H1,c:1):2);")) plot(enet, arrows=1) ## from Fig. 2 in Cardona et al. 2008: z <- read.evonet(text = "((1,((2,(3,(4)Y#H1)g)e,(((Y#H1, 5)h,6)f)X#H2)c)a,((X#H2,7)d,8)b)r;") z plot(z) ## Not run: if (require(igraph)) { plot(as.igraph(z)) } ## End(Not run)
This function implements a method for checking whether an incomplete set of distances satisfy certain conditions that might make it uniquely determine the edge weights of a given topology, T. It prints information about whether the graph with vertex set the set of leaves, denoted by X, and edge set the set of non-missing distance pairs, denoted by L, is connected or strongly non-bipartite. It then also checks whether L is a triplet cover for T.
ewLasso(X, phy)ewLasso(X, phy)
X |
a distance matrix. |
phy |
an unrooted tree of class |
Missing values must be represented by either NA or a negative value.
This implements a method for checking whether an incomplete set of distances satisfies certain conditions that might make it uniquely determine the edge weights of a given topology, T. It prints information about whether the graph, G, with vertex set the set of leaves, denoted by X, and edge set the set of non-missing distance pairs, denoted by L, is connected or strongly non-bipartite. It also checks whether L is a triplet cover for T. If G is not connected, then T does not need to be the only topology satisfying the input incomplete distances. If G is not strongly non-bipartite then the edge-weights of the edges of T are not the unique ones for which the input distance is satisfied. If L is a triplet cover, then the input distance matrix uniquely determines the edge weights of T. See Dress et al. (2012) for details.
NULL, the results are printed in the console.
Andrei Popescu
Dress, A. W. M., Huber, K. T., and Steel, M. (2012) ‘Lassoing’ a phylogentic tree I: basic properties, shellings and covers. Journal of Mathematical Biology, 65(1), 77–105.
The two FastME functions (balanced and OLS) perform the minimum evolution algorithm of Desper and Gascuel (2002).
fastme.bal(X, nni = TRUE, spr = TRUE, tbr = FALSE) fastme.ols(X, nni = TRUE)fastme.bal(X, nni = TRUE, spr = TRUE, tbr = FALSE) fastme.ols(X, nni = TRUE)
X |
a distance matrix; may be an object of class |
nni |
a logical value; TRUE to perform NNIs (default). |
spr |
ditto for SPRs. |
tbr |
ignored (see details). |
The code to perform topology searches based on TBR (tree bisection and
reconnection) did not run correctly and has been removed after the
release of ape 5.3. A warning is issued if tbr = TRUE.
an object of class "phylo".
original C code by Richard Desper; adapted and ported to R by Vincent Lefort [email protected]
Desper, R. and Gascuel, O. (2002) Fast and accurate phylogeny reconstruction algorithms based on the minimum-evolution principle. Journal of Computational Biology, 9, 687–705.
nj, bionj,
write.tree, read.tree,
dist.dna
### From Saitou and Nei (1987, Table 1): x <- c(7, 8, 11, 13, 16, 13, 17, 5, 8, 10, 13, 10, 14, 5, 7, 10, 7, 11, 8, 11, 8, 12, 5, 6, 10, 9, 13, 8) M <- matrix(0, 8, 8) M[lower.tri(M)] <- x M <- t(M) M[lower.tri(M)] <- x dimnames(M) <- list(1:8, 1:8) tr <- fastme.bal(M) plot(tr, "u") ### a less theoretical example data(woodmouse) trw <- fastme.bal(dist.dna(woodmouse)) plot(trw)### From Saitou and Nei (1987, Table 1): x <- c(7, 8, 11, 13, 16, 13, 17, 5, 8, 10, 13, 10, 14, 5, 7, 10, 7, 11, 8, 11, 8, 12, 5, 6, 10, 9, 13, 8) M <- matrix(0, 8, 8) M[lower.tri(M)] <- x M <- t(M) M[lower.tri(M)] <- x dimnames(M) <- list(1:8, 1:8) tr <- fastme.bal(M) plot(tr, "u") ### a less theoretical example data(woodmouse) trw <- fastme.bal(dist.dna(woodmouse)) plot(trw)
This function computes the gamma-statistic which summarizes the information contained in the inter-node intervals of a phylogeny. It is assumed that the tree is ultrametric. Note that the function does not check that the tree is effectively ultrametric, so if it is not, the returned result may not be meaningful.
gammaStat(phy)gammaStat(phy)
phy |
an object of class |
The gamma-statistic is a summary of the information contained in the
inter-node intervals of a phylogeny; it follows, under the assumption
that the clade diversified with constant rates, a normal distribution
with mean zero and standard-deviation unity (Pybus and Harvey
2000). Thus, the null hypothesis that the clade diversified with
constant rates may be tested with 2*(1 -
pnorm(abs(gammaStat(phy)))) for a two-tailed test, or 1 -
pnorm(abs(gammaStat(phy))) for a one-tailed test, both returning
the corresponding P-value.
a numeric vector of length one.
Emmanuel Paradis
Pybus, O. G. and Harvey, P. H. (2000) Testing macro-evolutionary models using incomplete molecular phylogenies. Proceedings of the Royal Society of London. Series B. Biological Sciences, 267, 2267–2272.
branching.times, ltt.plot, skyline
This function connects to the GenBank database and reads sequence annotations using accession number(s) given as argument.
getAnnotationsGenBank(access.nb, quiet = TRUE)getAnnotationsGenBank(access.nb, quiet = TRUE)
access.nb |
a vector of mode character giving the accession numbers. |
quiet |
a logical value indicating whether to show the progress of the downloads. |
The sequence annotations (a.k.a. feature list) are returned in a data frame with five or six columns: start, end, type, product, others, and gene (the last being optional). This is the same information that can be downloaded from NCBI's Web interface by clicking on ‘Send to:’, ‘File’, and then selecting ‘Feature Table’ under ‘Format’.
A warning is given if some features are incomplete (this information is then dropped from the returned object).
A warning is given if some accession numbers are not found on GenBank.
One of the followings: (i) a data frame if access.nb contains a
single accession number; (ii) a list of data frames if
access.nb contains several accession numbers, the names are set
with access.nb (if some accession numbers are not found on
GenBank, the corresponding entries are set to NULL); (iii)
NULL if all accession numbers are not found on GenBank.
Emmanuel Paradis
read.GenBank, read.gff,
DNAbin
## The 8 sequences of tanagers (Ramphocelus): ref <- c("U15717", "U15718", "U15719", "U15720", "U15721", "U15722", "U15723", "U15724") ## Copy/paste or type the following commands if you ## want to try them. ## Not run: annot.rampho <- getAnnotationsGenBank(ref) annot.rampho ## check all annotations are the same: unique(do.call(rbind, annot.rampho)[, -5]) ## End(Not run)## The 8 sequences of tanagers (Ramphocelus): ref <- c("U15717", "U15718", "U15719", "U15720", "U15721", "U15722", "U15723", "U15724") ## Copy/paste or type the following commands if you ## want to try them. ## Not run: annot.rampho <- getAnnotationsGenBank(ref) annot.rampho ## check all annotations are the same: unique(do.call(rbind, annot.rampho)[, -5]) ## End(Not run)
This data set describes an estimated clock-like phylogeny of 193 HIV-1 group M sequences sampled in the Democratic Republic of Congo.
data(hivtree.newick) data(hivtree.table)data(hivtree.newick) data(hivtree.table)
hivtree.newick is a string with the tree in Newick format.
The data frame hivtree.table contains the corresponding internode
distances.
This is a data example from Strimmer and Pybus (2001).
Strimmer, K. and Pybus, O. G. (2001) Exploring the demographic history of DNA sequences using the generalized skyline plot. Molecular Biology and Evolution, 18, 2298–2305.
coalescent.intervals, collapsed.intervals
howmanytrees calculates the number of possible phylogenetic
trees for a given number of tips.
LargeNumber is a utility function to compute (approximately)
large numbers from the power .
howmanytrees(n, rooted = TRUE, binary = TRUE, labeled = TRUE, detail = FALSE) LargeNumber(a, b) ## S3 method for class 'LargeNumber' print(x, latex = FALSE, digits = 1, ...)howmanytrees(n, rooted = TRUE, binary = TRUE, labeled = TRUE, detail = FALSE) LargeNumber(a, b) ## S3 method for class 'LargeNumber' print(x, latex = FALSE, digits = 1, ...)
n |
a positive numeric integer giving the number of tips. |
rooted |
a logical indicating whether the trees are rooted
(default is |
binary |
a logical indicating whether the trees are bifurcating
(default is |
labeled |
a logical indicating whether the trees have tips
labeled (default is |
detail |
a logical indicating whether the eventual intermediate
calculations should be returned (default is |
a, b
|
two numbers. |
x |
an object of class |
latex |
a logical value specifying whether to print the number in LaTeX code in addition to return it. |
digits |
the number of digits printed for the real part of the
large number (unused if |
... |
(unused). |
In the cases of labeled binary trees, the calculation is done directly
and a single numeric value is returned (or an object of class
"LargeNumber").
For multifurcating trees, and bifurcating, rooted, unlabeled trees,
the calculation is done iteratively for 1 to n tips. Thus the
user can print all the intermediate values if detail = TRUE, or
only a single value if detail = FALSE (the default).
For multifurcating trees, if detail = TRUE, a matrix is
returned with the number of tips as rows (named from 1 to
n), and the number of nodes as columns (named from 1 to
n - 1). For bifurcating, rooted, unlabeled trees, a vector is
returned with names equal to the number of tips (from 1 to
n).
The number of unlabeled trees (aka tree shapes) can be computed only for the rooted binary cases.
Note that if an infinite value (Inf) is returned this does not
mean that there is an infinite number of trees (this cannot be if the
number of tips is finite), but that the calculation is beyond the
limits of the computer. Only for the cases of rooted, binary, labeled
topologies an approximate number is returned in the form a
"LargeNumber" object.
a single numeric value, an object of class "LargeNumber", or in
the case where detail = TRUE is used, a named vector or
matrix.
Emmanuel Paradis
Felsenstein, J. (2004) Inferring Phylogenies. Sunderland: Sinauer Associates.
The vignette "RandomTopologies" gives more details and many examples of these calculations.
### Table 3.1 in Felsenstein 2004: for (i in c(1:20, 30, 40, 50)) cat(paste(i, howmanytrees(i), sep = "\t"), sep ="\n") ### Table 3.6: howmanytrees(8, binary = FALSE, detail = TRUE)### Table 3.1 in Felsenstein 2004: for (i in c(1:20, 30, 40, 50)) cat(paste(i, howmanytrees(i), sep = "\t"), sep ="\n") ### Table 3.6: howmanytrees(8, binary = FALSE, detail = TRUE)
This function allows to identify a clade on a plotted tree by clicking
on the plot with the mouse. The tree, specified in the argument
x, must be plotted beforehand.
## S3 method for class 'phylo' identify(x, nodes = TRUE, tips = FALSE, labels = FALSE, quiet = FALSE, ...)## S3 method for class 'phylo' identify(x, nodes = TRUE, tips = FALSE, labels = FALSE, quiet = FALSE, ...)
x |
an object of class |
nodes |
a logical specifying whether to identify the node. |
tips |
a logical specifying whether to return the tip information. |
labels |
a logical specifying whether to return the labels; by default only the numbers are returned. |
quiet |
a logical controlling whether to print a message inviting the user to click on the tree. |
... |
further arguments to be passed to or from other methods. |
By default, the clade is identified by its number as found in the
‘edge’ matrix of the tree. If tips = TRUE, the tips descending
from the identified node are returned, possibly together with the
node. If labels = TRUE, the labels are returned (if the tree
has no node labels, then the node numbered is returned).
The node is identified by the shortest distance where the click occurs. If the click occurs close to a tip, the function returns its information.
A list with one or two vectors named "tips" and/or
"nodes" with the identification of the tips and/or of the
nodes.
This function does not add anything on the plot, but it can be wrapped
with, e.g., nodelabels (see example), or its results can
be sent to, e.g., drop.tip.
Emmanuel Paradis
plot.phylo, nodelabels,
identify for the generic function
## Not run: tr <- rtree(20) f <- function(col) { o <- identify(tr) nodelabels(node=o$nodes, pch = 19, col = col) } plot(tr) f("red") # click near a node f("green") # click near another one ## End(Not run)## Not run: tr <- rtree(20) f <- function(col) { o <- identify(tr) nodelabels(node=o$nodes, pch = 19, col = col) } plot(tr) f("red") # click near a node f("green") # click near another one ## End(Not run)
This function plots an image of an alignment of nucleotide sequences.
## S3 method for class 'DNAbin' image(x, what, col, bg = "white", xlab = "", ylab = "", show.labels = TRUE, cex.lab = 1, legend = TRUE, grid = FALSE, show.bases = FALSE, base.cex = 1, base.font = 1, base.col = "black", scheme = "Ape_NT", ...)## S3 method for class 'DNAbin' image(x, what, col, bg = "white", xlab = "", ylab = "", show.labels = TRUE, cex.lab = 1, legend = TRUE, grid = FALSE, show.bases = FALSE, base.cex = 1, base.font = 1, base.col = "black", scheme = "Ape_NT", ...)
x |
a matrix of DNA sequences (class |
what |
a vector of characters specifying the bases to visualize. If missing, this is set to “a”, “g”, “c”, “t”, “n”, and “-” (in this order). |
col |
a vector of colours. If missing, this is set to “red”,
“yellow”, “green”, “blue”, “grey”, and “black”. If it is
shorter (or longer) than |
bg |
the colour used for nucleotides whose base is not among
|
xlab |
the label for the x-axis; none by default. |
ylab |
Idem for the y-axis. Note that by default, the labels of the sequences are printed on the y-axis (see next option). |
show.labels |
a logical controlling whether the sequence labels
are printed ( |
cex.lab |
a single numeric controlling the size of the sequence labels.
Use |
legend |
a logical controlling whether the legend is plotted
( |
grid |
a logical controlling whether to draw a grid ( |
show.bases |
a logical controlling whether to show the base symbols
( |
base.cex, base.font, base.col
|
control the aspect of the base
symbols (ignored if the previous is |
scheme |
a predefined color scheme. For amino acid options are "Ape_AA", "Zappo_AA", "Clustal", "Polarity" and "Transmembrane_tendency", for nucleotides "Ape_NT" and "RY_NT". |
... |
further arguments passed to
|
The idea of this function is to allow flexible plotting and colouring of a nucleotide alignment. By default, the most common bases (a, g, c, t, and n) and alignment gap are plotted using a standard colour scheme.
It is possible to plot only one base specified as what with a
chosen colour: this might be useful to check, for instance, the
distribution of alignment gaps (image(x, "-")) or missing data
(see examples).
Emmanuel Paradis, Klaus Schliep
DNAbin, del.gaps, alex,
alview, all.equal.DNAbin,
clustal, grid,
image.AAbin
data(woodmouse) image(woodmouse) rug(seg.sites(woodmouse), -0.02, 3, 1) image(woodmouse, "n", "blue") # show missing data image(woodmouse, c("g", "c"), "green") # G+C par(mfcol = c(2, 2)) ### barcoding style: for (x in c("a", "g", "c", "t")) image(woodmouse, x, "black", cex.lab = 0.5, cex.axis = 0.7) par(mfcol = c(1, 1)) ### zoom on a portion of the data: image(woodmouse[11:15, 1:50], c("a", "n"), c("blue", "grey")) grid(50, 5, col = "black") ### see the guanines on a black background: image(woodmouse, "g", "yellow", "black") ### Amino acid X <- trans(woodmouse, 2) image(X) # default ape colors image(X, scheme="Clustal") # Clustal coloringdata(woodmouse) image(woodmouse) rug(seg.sites(woodmouse), -0.02, 3, 1) image(woodmouse, "n", "blue") # show missing data image(woodmouse, c("g", "c"), "green") # G+C par(mfcol = c(2, 2)) ### barcoding style: for (x in c("a", "g", "c", "t")) image(woodmouse, x, "black", cex.lab = 0.5, cex.axis = 0.7) par(mfcol = c(1, 1)) ### zoom on a portion of the data: image(woodmouse[11:15, 1:50], c("a", "n"), c("blue", "grey")) grid(50, 5, col = "black") ### see the guanines on a black background: image(woodmouse, "g", "yellow", "black") ### Amino acid X <- trans(woodmouse, 2) image(X) # default ape colors image(X, scheme="Clustal") # Clustal coloring
Initialize a corPhyl correlation structure object.
Does the same as Initialize.corStruct, but also checks the row names of data and builds an index.
## S3 method for class 'corPhyl' Initialize(object, data, ...)## S3 method for class 'corPhyl' Initialize(object, data, ...)
object |
An object inheriting from class |
data |
The data to use. If it contains rownames, they are matched with the tree tip labels, otherwise data are supposed to be in the same order than tip labels and a warning is sent. |
... |
some methods for this generic require additional arguments. None are used in this method. |
An initialized object of same class as object.
Julien Dutheil [email protected]
corClasses, Initialize.corStruct.
This function tests whether a phylogenetic tree is binary.
is.binary(phy) ## S3 method for class 'phylo' is.binary(phy) ## S3 method for class 'multiPhylo' is.binary(phy) ## S3 method for class 'tree' is.binary(phy)is.binary(phy) ## S3 method for class 'phylo' is.binary(phy) ## S3 method for class 'multiPhylo' is.binary(phy) ## S3 method for class 'tree' is.binary(phy)
phy |
an object of class |
The test differs whether the tree is rooted or not. An urooted tree is considered binary if all its nodes are of degree three (i.e., three edges connect to each node). A rooted tree is considered binary if all nodes (including the root node) have exactly two descendant nodes, so that they are of degree three expect the root which is of degree 2.
The test ignores branch lengths. Consider using di2multi
if you want to treat zero-branch lengths as resulting from
multichotomies.
is.binary.tree is deprecated and will be removed (sometime):
it calls is.binary.
a logical vector.
Emmanuel Paradis
is.rooted, is.ultrametric, multi2di
is.binary(rtree(10)) is.binary(rtree(10, rooted = FALSE)) is.binary(stree(10)) x <- setNames(rmtree(10, 10), LETTERS[1:10]) is.binary(x)is.binary(rtree(10)) is.binary(rtree(10, rooted = FALSE)) is.binary(stree(10)) x <- setNames(rmtree(10, 10), LETTERS[1:10]) is.binary(x)
is.compatible is a generic function with a method for the class
"bitsplits". It checks whether a set of splits is compatible
using the arecompatible function.
is.compatible(obj) ## S3 method for class 'bitsplits' is.compatible(obj) arecompatible(x, y, n)is.compatible(obj) ## S3 method for class 'bitsplits' is.compatible(obj) arecompatible(x, y, n)
obj |
an object of class |
x, y
|
a vector of mode raw. |
n |
the number of taxa in the splits. |
TRUE if the splits are compatible, FALSE otherwise.
Andrei Popescu
This function tests whether a list of tip labels is monophyletic on a given tree.
is.monophyletic(phy, tips, reroot = !is.rooted(phy), plot = FALSE, ...)is.monophyletic(phy, tips, reroot = !is.rooted(phy), plot = FALSE, ...)
phy |
a phylogenetic tree description of class |
tips |
a vector of mode numeric or character specifying the tips to be tested. |
reroot |
a logical value. If |
plot |
a logical value. If |
... |
further arguments passed to |
If phy is rooted, the test is done on the rooted tree, otherwise
the tree is first unrooted, then arbitrarily rerooted, in order to be
independent on the current position of the root. That is, the test
asks if tips could be monophyletic given any favourably rooting
of phy.
If phy is unrooted the test is done on an unrooted tree, unless
reroot = FALSE is specified.
If labels in the list tips are given as characters, they need
to be spelled as in the object phy.
a logical value.
Johan Nylander [email protected]
data(bird.orders) ## Test one monophyletic and one paraphyletic group: is.monophyletic(phy = bird.orders, tips = c("Ciconiiformes", "Gruiformes")) is.monophyletic(bird.orders, c("Passeriformes", "Ciconiiformes", "Gruiformes"))data(bird.orders) ## Test one monophyletic and one paraphyletic group: is.monophyletic(phy = bird.orders, tips = c("Ciconiiformes", "Gruiformes")) is.monophyletic(bird.orders, c("Passeriformes", "Ciconiiformes", "Gruiformes"))
This function tests whether a tree is ultrametric using the distances from each tip to the root.
is.ultrametric(phy, ...) ## S3 method for class 'phylo' is.ultrametric(phy, tol = .Machine$double.eps^0.5, option = 1, ...) ## S3 method for class 'multiPhylo' is.ultrametric(phy, tol = .Machine$double.eps^0.5, option = 1, ...)is.ultrametric(phy, ...) ## S3 method for class 'phylo' is.ultrametric(phy, tol = .Machine$double.eps^0.5, option = 1, ...) ## S3 method for class 'multiPhylo' is.ultrametric(phy, tol = .Machine$double.eps^0.5, option = 1, ...)
phy |
an object of class |
tol |
a numeric >= 0, variation below this value are considered non-significant. |
option |
an integer (1 or 2; see details). |
... |
arguments passed among methods. |
The test is based on the distances from each tip to the root and a
criterion: if option = 1, the criterion is the scaled range
((max - min/max)), if option = 2, the variance is used (this
was the method used until ape 3.5). The default criterion is invariant
to linear changes of the branch lengths.
a logical vector.
Emmanuel Paradis
is.ultrametric(rtree(10)) is.ultrametric(rcoal(10))is.ultrametric(rtree(10)) is.ultrametric(rcoal(10))
The main argument is a list of (rooted) trees which are plotted on the same scale.
kronoviz(x, layout = length(x), horiz = TRUE, ..., direction = ifelse(horiz, "rightwards", "upwards"), side = 2)kronoviz(x, layout = length(x), horiz = TRUE, ..., direction = ifelse(horiz, "rightwards", "upwards"), side = 2)
x |
a list of (rooted) trees of class |
layout |
an integer giving the number of trees plotted simultaneously; by default all. |
horiz |
a logical specifying whether the trees should be plotted rightwards (the default) or upwards. |
... |
further arguments passed to |
direction |
a character string specifying the direction of the tree. Four values are possible: "rightwards" (the default), "leftwards", "upwards", and "downwards". |
side |
Where to put the axis, see example. |
The size of the individual plots is proportional to the size of the trees.
NULL
Emmanuel Paradis, Klaus Schliep
TR <- replicate(10, rcoal(sample(11:20, size = 1)), simplify = FALSE) kronoviz(TR) kronoviz(TR, side = 1) kronoviz(TR, horiz = FALSE, type = "c", show.tip.label = FALSE) kronoviz(TR, direction = "d", side = c(1,2))TR <- replicate(10, rcoal(sample(11:20, size = 1)), simplify = FALSE) kronoviz(TR) kronoviz(TR, side = 1) kronoviz(TR, horiz = FALSE, type = "c", show.tip.label = FALSE) kronoviz(TR, direction = "d", side = c(1,2))
These functions work on a vector of character strings storing bi- or trinomial species names, typically “Genus_species_subspecies”.
label2table(x, sep = NULL, as.is = FALSE) stripLabel(x, species = FALSE, subsp = TRUE, sep = NULL) abbreviateGenus(x, genus = TRUE, species = FALSE, sep = NULL)label2table(x, sep = NULL, as.is = FALSE) stripLabel(x, species = FALSE, subsp = TRUE, sep = NULL) abbreviateGenus(x, genus = TRUE, species = FALSE, sep = NULL)
x |
a vector of mode character. |
sep |
the separator (a single character) between the taxonomic levels (see details). |
as.is |
a logical specifying whether to convert characters into factors (like in |
species, subsp, genus
|
a logical specifying whether the taxonomic level is concerned by the operation. |
label2table returns a data frame with three columns named “genus”, “species”, and “subspecies” (with NA if the level is missing).
stripLabel deletes the subspecies names from the input. If species = TRUE, the species names are also removed, thus returning only the genus names.
abbreviateGenus abbreviates the genus names keeping only the first letter. If species = TRUE, the species names are abbreviated.
By default, these functions try to guess what is the separator between the genus, species and/or subspecies names. If an underscore is present in the input, then this character is assumed to be the separator; otherwise, a space. If this does not work, you can specify sep to its appropriate value.
A vector of mode character or a data frame.
Emmanuel Paradis
makeLabel, makeNodeLabel,
mixedFontLabel, updateLabel,
checkLabel
x <- c("Panthera_leo", "Panthera_pardus", "Panthera_onca", "Panthera_uncia", "Panthera_tigris_altaica", "Panthera_tigris_amoyensis") label2table(x) stripLabel(x) stripLabel(x, TRUE) abbreviateGenus(x) abbreviateGenus(x, species = TRUE) abbreviateGenus(x, genus = FALSE, species = TRUE)x <- c("Panthera_leo", "Panthera_pardus", "Panthera_onca", "Panthera_uncia", "Panthera_tigris_altaica", "Panthera_tigris_amoyensis") label2table(x) stripLabel(x) stripLabel(x, TRUE) abbreviateGenus(x) abbreviateGenus(x, species = TRUE) abbreviateGenus(x, genus = FALSE, species = TRUE)
This function reorganizes the internal structure of the tree to get the ladderized effect when plotted.
ladderize(phy, right = TRUE)ladderize(phy, right = TRUE)
phy |
an object of class |
right |
a logical specifying whether the smallest clade is on the
right-hand side (when the tree is plotted upwards), or the opposite
(if |
Emmanuel Paradis
tr <- rcoal(50) layout(matrix(1:4, 2, 2)) plot(tr, main = "normal") plot(ladderize(tr), main = "right-ladderized") plot(ladderize(tr, FALSE), main = "left-ladderized") layout(matrix(1, 1))tr <- rcoal(50) layout(matrix(1:4, 2, 2)) plot(tr, main = "normal") plot(ladderize(tr), main = "right-ladderized") plot(ladderize(tr, FALSE), main = "left-ladderized") layout(matrix(1, 1))
Substitutes leading and trailing gaps in aligned sequences with
N. The gaps in the middle of the sequences are left unchanged.
latag2n(x)latag2n(x)
x |
an object of class |
This function is called by others in ape and in pegas. It is documented here in case it needs to be called by other packages.
an object of class "DNAbin".
Emmanuel Paradis
x <- as.DNAbin(matrix(c("-", "A", "G", "-", "T", "C"), 2, 3)) y <- latag2n(x) alview(x) alview(y)x <- as.DNAbin(matrix(c("-", "A", "G", "-", "T", "C"), 2, 3)) y <- latag2n(x) alview(x) alview(y)
Function lmorigin computes a multiple linear regression and performs tests of significance of the equation parameters (F-test of R-square and t-tests of regression coefficients) using permutations.
The regression line can be forced through the origin. Testing the significance in that case requires a special permutation procedure. This option was developed for the analysis of independent contrasts, which requires regression through the origin. A permutation test, described by Legendre & Desdevises (2009), is needed to analyze contrasts that are not normally distributed.
lmorigin(formula, data, origin=TRUE, nperm=999, method=NULL, silent=FALSE)lmorigin(formula, data, origin=TRUE, nperm=999, method=NULL, silent=FALSE)
formula |
|
data |
A data frame containing the two variables specified in the formula. |
origin |
|
nperm |
Number of permutations for the tests. If |
method |
|
silent |
Informative messages and the time to compute the tests will not be written to the R console if silent=TRUE. Useful when the function is called by a numerical simulation function. |
The permutation F-test of R-square is always done by permutation of the raw data. When there is a single explanatory variable, permutation of the raw data is used for the t-test of the single regression coefficient, whatever the method chosen by the user. The rationale is found in Anderson & Legendre (1999).
The print.lmorigin function prints out the results of the parametric tests (in all cases) and the results of the permutational tests (when nperm > 0).
reg |
The regression output object produced by function |
p.param.t.2tail |
Parametric probabilities for 2-tailed tests of the regression coefficients. |
p.param.t.1tail |
Parametric probabilities for 1-tailed tests of the regression coefficients. Each test is carried out in the direction of the sign of the coefficient. |
p.perm.t.2tail |
Permutational probabilities for 2-tailed tests of the regression coefficients. |
p.perm.t.1tail |
Permutational probabilities for 1-tailed tests of the regression coefficients. Each test is carried out in the direction of the sign of the coefficient. |
p.perm.F |
Permutational probability for the F-test of R-square. |
origin |
TRUE is regression through the origin has been computed, FALSE if multiple regression with estimation of the intercept has been used. |
nperm |
Number of permutations used in the permutation tests. |
method |
Permutation method for the t-tests of the regression coefficients: |
var.names |
Vector containing the names of the variables used in the regression. |
call |
The function call. |
Pierre Legendre, Universite de Montreal
Anderson, M. J. and Legendre, P. (1999) An empirical comparison of permutation methods for tests of partial regression coefficients in a linear model. Journal of Statistical Computation and Simulation, 62, 271–303.
Legendre, P. and Desdevises, Y. (2009) Independent contrasts and regression through the origin. Journal of Theoretical Biology, 259, 727–743.
Sokal, R. R. and Rohlf, F. J. (1995) Biometry - The principles and practice of statistics in biological research. Third edition. New York: W. H. Freeman.
## Example 1 from Sokal & Rohlf (1995) Table 16.1 ## SO2 air pollution in 41 cities of the USA data(lmorigin.ex1) out <- lmorigin(SO2 ~ ., data=lmorigin.ex1, origin=FALSE, nperm=99) out ## Example 2: Contrasts computed on the phylogenetic tree of Lamellodiscus ## parasites. Response variable: non-specificity index (NSI); explanatory ## variable: maximum host size. Data from Table 1 of Legendre & Desdevises ## (2009). data(lmorigin.ex2) out <- lmorigin(NSI ~ MaxHostSize, data=lmorigin.ex2, origin=TRUE, nperm=99) out ## Example 3: random numbers y <- rnorm(50) X <- as.data.frame(matrix(rnorm(250),50,5)) out <- lmorigin(y ~ ., data=X, origin=FALSE, nperm=99) out## Example 1 from Sokal & Rohlf (1995) Table 16.1 ## SO2 air pollution in 41 cities of the USA data(lmorigin.ex1) out <- lmorigin(SO2 ~ ., data=lmorigin.ex1, origin=FALSE, nperm=99) out ## Example 2: Contrasts computed on the phylogenetic tree of Lamellodiscus ## parasites. Response variable: non-specificity index (NSI); explanatory ## variable: maximum host size. Data from Table 1 of Legendre & Desdevises ## (2009). data(lmorigin.ex2) out <- lmorigin(NSI ~ MaxHostSize, data=lmorigin.ex2, origin=TRUE, nperm=99) out ## Example 3: random numbers y <- rnorm(50) X <- as.data.frame(matrix(rnorm(250),50,5)) out <- lmorigin(y ~ ., data=X, origin=FALSE, nperm=99) out
This function draws the lineage-through time (LTT) plots predicted under a speciation-extinction model (aka birth-death model) with specified values of speciation and extinction rates (which may vary with time).
A prediction interval is plotted by default which requires to define a sample size (100 by default), and different curves can be combined.
LTT(birth = 0.1, death = 0, N = 100, Tmax = 50, PI = 95, scaled = TRUE, eps = 0.1, add = FALSE, backward = TRUE, ltt.style = list("black", 1, 1), pi.style = list("blue", 1, 2), ...)LTT(birth = 0.1, death = 0, N = 100, Tmax = 50, PI = 95, scaled = TRUE, eps = 0.1, add = FALSE, backward = TRUE, ltt.style = list("black", 1, 1), pi.style = list("blue", 1, 2), ...)
birth |
the speciation rate, this may be either a numeric value
or a funtion of time (named |
death |
id. for the extinction rate. |
N |
the size of the tree. |
Tmax |
the age of the root of the tree. |
PI |
the percentage value of the prediction interval; set this value to 0 to not draw this interval. |
scaled |
a logical values specifying whether to scale the
|
eps |
a numerical value giving the resolution of the time axis. |
add |
a logical values specifying whether to make a new plot (the default). |
backward |
a logical value: should the time axis be traced from the present (the default), or from the root of the tree? |
ltt.style |
a list with three elements giving the style of the
LTT curve with, respectively, the colour ( |
pi.style |
id. for the prediction interval. |
... |
arguments passed to |
For the moment, this works well when birth and death are
constant. Some improvements are under progress for time-dependent
rates (but see below for an example).
Emmanuel Paradis
Hallinan, N. (2012) The generalized time variable reconstructed birth–death process. Journal of Theoretical Biology, 300, 265–276.
Paradis, E. (2011) Time-dependent speciation and extinction from phylogenies: a least squares approach. Evolution, 65, 661–672.
Paradis, E. (2015) Random phylogenies and the distribution of branching times. Journal of Theoretical Biology, 387, 39–45.
### predicted LTT plot under a Yule model with lambda = 0.1 ### and 50 species after 50 units of time... LTT(N = 50) ### ... and with a birth-death model with the same rate of ### diversification (try with N = 500): LTT(0.2, 0.1, N = 50, PI = 0, add = TRUE, ltt.style = list("red", 2, 1)) ### predictions under different tree sizes: layout(matrix(1:4, 2, 2, byrow = TRUE)) for (N in c(50, 100, 500, 1000)) { LTT(0.2, 0.1, N = N) title(paste("N =", N)) } layout(1) ## Not run: ### speciation rate decreasing with time birth.logis <- function(t) 1/(1 + exp(0.02 * t + 4)) LTT(birth.logis) LTT(birth.logis, 0.05) LTT(birth.logis, 0.1) ## End(Not run)### predicted LTT plot under a Yule model with lambda = 0.1 ### and 50 species after 50 units of time... LTT(N = 50) ### ... and with a birth-death model with the same rate of ### diversification (try with N = 500): LTT(0.2, 0.1, N = 50, PI = 0, add = TRUE, ltt.style = list("red", 2, 1)) ### predictions under different tree sizes: layout(matrix(1:4, 2, 2, byrow = TRUE)) for (N in c(50, 100, 500, 1000)) { LTT(0.2, 0.1, N = N) title(paste("N =", N)) } layout(1) ## Not run: ### speciation rate decreasing with time birth.logis <- function(t) 1/(1 + exp(0.02 * t + 4)) LTT(birth.logis) LTT(birth.logis, 0.05) LTT(birth.logis, 0.1) ## End(Not run)
These functions provide tools for plotting the numbers of lineages through time from phylogenetic trees.
ltt.plot(phy, xlab = "Time", ylab = "N", backward = TRUE, tol = 1e-6, ...) ltt.lines(phy, backward = TRUE, tol = 1e-6, ...) mltt.plot(phy, ..., dcol = TRUE, dlty = FALSE, legend = TRUE, xlab = "Time", ylab = "N", log = "", backward = TRUE, tol = 1e-6) ltt.coplot(phy, backward = TRUE, ...) ltt.plot.coords(phy, backward = TRUE, tol = 1e-6, type = "S")ltt.plot(phy, xlab = "Time", ylab = "N", backward = TRUE, tol = 1e-6, ...) ltt.lines(phy, backward = TRUE, tol = 1e-6, ...) mltt.plot(phy, ..., dcol = TRUE, dlty = FALSE, legend = TRUE, xlab = "Time", ylab = "N", log = "", backward = TRUE, tol = 1e-6) ltt.coplot(phy, backward = TRUE, ...) ltt.plot.coords(phy, backward = TRUE, tol = 1e-6, type = "S")
phy |
an object of class |
xlab |
a character string (or a variable of mode character)
giving the label for the |
ylab |
idem for the |
backward |
a logical value: should the time axis be traced from the present (the default), or from the root of the tree? |
tol |
a numeric value (see details). |
... |
in the cases of |
dcol |
a logical specifying whether the different curves should
be differentiated with colors (default is |
dlty |
a logical specifying whether the different curves should
be differentiated with patterns of dots and dashes (default is
|
legend |
a logical specifying whether a legend should be plotted. |
log |
a character string specifying which axis(es) to be
log-transformed; must be one of the followings: |
type |
either |
ltt.plot does a simple lineages through time (LTT)
plot. Additional arguments (...) may be used to change, for
instance, the limits on the axes (with xlim and/or
ylim) or other graphical settings (col for the color,
lwd for the line thickness, lty for the line type may be
useful; see par for an exhaustive listing of
graphical parameters). The -axis can be log-transformed by
adding the following option: log = "y".
The option tol is used as follows: first the most distant tip
from the root is found, then all tips whose distance to the root is
not different from the previous one more than tol are
considered to be contemporaneous with it.
If the tree is not ultrametric, the plot is done assuming the tips, except the most distant from the root, represent extinction events. If a root edge is present, it is taken into account.
ltt.lines adds a LTT curve to an existing plot. Additional
arguments (...) may be used to change the settings of the added
line.
mltt.plot does a multiple LTT plot taking as arguments one or
several trees. These trees may be given as objects of class
"phylo" (single trees) and/or "multiPhylo" (multiple
trees). Any number of objects may be given. This function is mainly
for exploratory analyses with the advantages that the axes are set
properly to view all lines, and the legend is plotted by default. The
plot will certainly make sense if all trees have their
most-distant-from-the-root tips contemporaneous (i.e., trees with only
extinct lineages will not be represented properly). For more flexible
settings of line drawings, it may be better to combine
ltt.plot() with successive calls of ltt.lines() (see
examples).
ltt.coplot is meant to show how to set a tree and a LTT plots
on the same scales. All extra arguments modify only the appearance of
the tree. The code can be easily edited and tailored.
ltt.plot.coords returns a two-column matrix with the time
points and the number of lineages, respectively.
type = "S" returns the number of lineages to the left of (or "up to")
the corresponding point in time, while type = "s" returns the number of
lineages to the right of this point (i.e, between that time and the next).
Emmanuel Paradis
Harvey, P. H., May, R. M. and Nee, S. (1994) Phylogenies without fossils. Evolution, 48, 523–529.
Nee, S., Holmes, E. C., Rambaut, A. and Harvey, P. H. (1995) Inferring population history from molecular phylogenies. Philosophical Transactions of the Royal Society of London. Series B. Biological Sciences, 349, 25–31.
kronoviz, skyline, LTT,
branching.times, birthdeath,
bd.ext, yule.cov, bd.time;
plot for the basic plotting function in R
data(bird.families) opar <- par(mfrow = c(2, 1)) ltt.plot(bird.families) title("Lineages Through Time Plot of the Bird Families") ltt.plot(bird.families, log = "y") title(main = "Lineages Through Time Plot of the Bird Families", sub = "(with logarithmic transformation of the y-axis)") par(opar) ### to plot the tree and the LTT plot together data(bird.orders) layout(matrix(1:4, 2, 2)) plot(bird.families, show.tip.label = FALSE) ltt.plot(bird.families, main = "Bird families") plot(bird.orders, show.tip.label = FALSE) ltt.plot(bird.orders, main = "Bird orders") layout(1) ### better with ltt.coplot(): ltt.coplot(bird.families, show.tip.label = FALSE, x.lim = 27.5) data(chiroptera) chiroptera <- compute.brlen(chiroptera) ltt.coplot(chiroptera, show.tip.label = FALSE, type = "c") ### with extinct lineages and a root edge: omar <- par("mar") set.seed(31) tr <- rlineage(0.2, 0.15) tr$root.edge <- 5 ltt.coplot(tr, show.tip.label = FALSE, x.lim = 55) ## compare with: ## ltt.coplot(drop.fossil(tr), show.tip.label = FALSE) layout(1) par(mar = omar) mltt.plot(bird.families, bird.orders) ### Generates 10 random trees with 23 tips: TR <- replicate(10, rcoal(23), FALSE) ### Give names to each tree: names(TR) <- paste("random tree", 1:10) ### And specify the class of the list so that mltt.plot() ### does not trash it! class(TR) <- "multiPhylo" mltt.plot(TR, bird.orders) ### And now for something (not so) completely different: ltt.plot(bird.orders, lwd = 2) for (i in 1:10) ltt.lines(TR[[i]], lty = 2) legend(-20, 10, lwd = c(2, 1), lty = c(1, 2), bty = "n", legend = c("Bird orders", "Random (coalescent) trees"))data(bird.families) opar <- par(mfrow = c(2, 1)) ltt.plot(bird.families) title("Lineages Through Time Plot of the Bird Families") ltt.plot(bird.families, log = "y") title(main = "Lineages Through Time Plot of the Bird Families", sub = "(with logarithmic transformation of the y-axis)") par(opar) ### to plot the tree and the LTT plot together data(bird.orders) layout(matrix(1:4, 2, 2)) plot(bird.families, show.tip.label = FALSE) ltt.plot(bird.families, main = "Bird families") plot(bird.orders, show.tip.label = FALSE) ltt.plot(bird.orders, main = "Bird orders") layout(1) ### better with ltt.coplot(): ltt.coplot(bird.families, show.tip.label = FALSE, x.lim = 27.5) data(chiroptera) chiroptera <- compute.brlen(chiroptera) ltt.coplot(chiroptera, show.tip.label = FALSE, type = "c") ### with extinct lineages and a root edge: omar <- par("mar") set.seed(31) tr <- rlineage(0.2, 0.15) tr$root.edge <- 5 ltt.coplot(tr, show.tip.label = FALSE, x.lim = 55) ## compare with: ## ltt.coplot(drop.fossil(tr), show.tip.label = FALSE) layout(1) par(mar = omar) mltt.plot(bird.families, bird.orders) ### Generates 10 random trees with 23 tips: TR <- replicate(10, rcoal(23), FALSE) ### Give names to each tree: names(TR) <- paste("random tree", 1:10) ### And specify the class of the list so that mltt.plot() ### does not trash it! class(TR) <- "multiPhylo" mltt.plot(TR, bird.orders) ### And now for something (not so) completely different: ltt.plot(bird.orders, lwd = 2) for (i in 1:10) ltt.lines(TR[[i]], lty = 2) legend(-20, 10, lwd = c(2, 1), lty = c(1, 2), bty = "n", legend = c("Bird orders", "Random (coalescent) trees"))
This is a generic function with methods for character vectors, trees
of class "phylo", lists of trees of class "multiPhylo",
and DNA sequences of class "DNAbin". All options for the class
character may be used in the other methods.
makeLabel(x, ...) ## S3 method for class 'character' makeLabel(x, len = 99, space = "_", make.unique = TRUE, illegal = "():;,[]", quote = FALSE, ...) ## S3 method for class 'phylo' makeLabel(x, tips = TRUE, nodes = TRUE, ...) ## S3 method for class 'multiPhylo' makeLabel(x, tips = TRUE, nodes = TRUE, ...) ## S3 method for class 'DNAbin' makeLabel(x, ...)makeLabel(x, ...) ## S3 method for class 'character' makeLabel(x, len = 99, space = "_", make.unique = TRUE, illegal = "():;,[]", quote = FALSE, ...) ## S3 method for class 'phylo' makeLabel(x, tips = TRUE, nodes = TRUE, ...) ## S3 method for class 'multiPhylo' makeLabel(x, tips = TRUE, nodes = TRUE, ...) ## S3 method for class 'DNAbin' makeLabel(x, ...)
x |
a vector of mode character or an object for which labels are to be changed. |
len |
the maximum length of the labels: those longer than ‘len’ will be truncated. |
space |
the character to replace spaces, tabulations, and linebreaks. |
make.unique |
a logical specifying whether duplicate labels
should be made unique by appending numerals; |
illegal |
a string specifying the characters to be deleted. |
quote |
a logical specifying whether to quote the labels;
|
tips |
a logical specifying whether tip labels are to be
modified; |
nodes |
a logical specifying whether node labels are to be
modified; |
... |
further arguments to be passed to or from other methods. |
The option make.unique does not work exactly in the same way
then the function of the same name: numbers are suffixed to all labels
that are identical (without separator). See the examples.
If there are 10–99 identical labels, the labels returned are "xxx01", "xxx02", etc, or "xxx001", "xxx002", etc, if they are 100–999, and so on. The number of digits added preserves the option ‘len’.
The default for ‘len’ makes labels short enough to be read by PhyML. Clustal accepts labels up to 30 character long.
An object of the appropriate class.
The current version does not perform well when trying to make very short unique labels (e.g., less than 5 character long).
Emmanuel Paradis
makeNodeLabel, make.unique,
make.names, abbreviate,
mixedFontLabel, label2table,
updateLabel, checkLabel
x <- rep("a", 3) makeLabel(x) make.unique(x) # <- from R's base x <- rep("aaaaa", 2) makeLabel(x, len = 3) # made unique and of length 3 makeLabel(x, len = 3, make.unique = FALSE)x <- rep("a", 3) makeLabel(x) make.unique(x) # <- from R's base x <- rep("aaaaa", 2) makeLabel(x, len = 3) # made unique and of length 3 makeLabel(x, len = 3, make.unique = FALSE)
This function makes node labels in a tree in a flexible way.
makeNodeLabel(phy, ...) ## S3 method for class 'phylo' makeNodeLabel(phy, method = "number", prefix = "Node", nodeList = list(), ...) ## S3 method for class 'multiPhylo' makeNodeLabel(phy, method = "number", prefix = "Node", nodeList = list(), ...)makeNodeLabel(phy, ...) ## S3 method for class 'phylo' makeNodeLabel(phy, method = "number", prefix = "Node", nodeList = list(), ...) ## S3 method for class 'multiPhylo' makeNodeLabel(phy, method = "number", prefix = "Node", nodeList = list(), ...)
phy |
an object of class |
method |
a character string giving the method used to create the
labels. Three choices are possible: |
prefix |
the prefix used if |
nodeList |
a named list specifying how nodes are names if
|
... |
further arguments passed to |
The three methods are described below:
“number”! The labels are created with 1, 2, ... prefixed
with the argument prefix; thus the default is to have
Node1, Node2, ... Set prefix = "" to have only numbers.
“md5sum”: For each node, the labels of the tips descendant from this node are extracted, sorted alphabetically, and written into a temporary file, then the md5sum of this file is extracted and used as label. This results in a 32-character string which is unique (even accross trees) for a given set of tip labels.
“user”: the argument nodeList must be a list with
names, the latter will be used as node labels. For each element of
nodeList, the tip labels of the tree are searched for
patterns present in this element: this is done using
grep. Then the most recent common ancestor of
the matching tips is given the corresponding names as labels. This
is repeated for each element of nodeList.
The method "user" can be used in combination with either of the
two others (see examples). Note that this method only modifies the
specified node labels (so that if the other nodes have already labels
they are not modified) while the two others change all labels.
an object of class "phylo".
Emmanuel Paradis
makeLabel, grep,
mixedFontLabel, label2table,
checkLabel
tr <- "((Pan_paniscus,Pan_troglodytes),((Homo_sapiens,Homo_erectus),Homo_abilis));" tr <- read.tree(text = tr) tr <- makeNodeLabel(tr, "u", nodeList = list(Pan = "Pan", Homo = "Homo")) plot(tr, show.node.label = TRUE) ### does not erase the previous node labels: tr <- makeNodeLabel(tr, "u", nodeList = list(Hominid = c("Pan","Homo"))) plot(tr, show.node.label = TRUE) ### the two previous commands could be combined: L <- list(Pan = "Pan", Homo = "Homo", Hominid = c("Pan","Homo")) tr <- makeNodeLabel(tr, "u", nodeList = L) ### combining different methods: tr <- makeNodeLabel(tr, c("n", "u"), prefix = "#", nodeList = list(Hominid = c("Pan","Homo"))) plot(tr, show.node.label = TRUE)tr <- "((Pan_paniscus,Pan_troglodytes),((Homo_sapiens,Homo_erectus),Homo_abilis));" tr <- read.tree(text = tr) tr <- makeNodeLabel(tr, "u", nodeList = list(Pan = "Pan", Homo = "Homo")) plot(tr, show.node.label = TRUE) ### does not erase the previous node labels: tr <- makeNodeLabel(tr, "u", nodeList = list(Hominid = c("Pan","Homo"))) plot(tr, show.node.label = TRUE) ### the two previous commands could be combined: L <- list(Pan = "Pan", Homo = "Homo", Hominid = c("Pan","Homo")) tr <- makeNodeLabel(tr, "u", nodeList = L) ### combining different methods: tr <- makeNodeLabel(tr, c("n", "u"), prefix = "#", nodeList = list(Hominid = c("Pan","Homo"))) plot(tr, show.node.label = TRUE)
This function computes Mantel's permutation test for similarity of two
matrices. It permutes the rows and columns of the second matrix
randomly and calculates a -statistic.
mantel.test(m1, m2, nperm = 999, graph = FALSE, alternative = "two.sided", ...)mantel.test(m1, m2, nperm = 999, graph = FALSE, alternative = "two.sided", ...)
m1 |
a numeric matrix giving a measure of pairwise distances, correlations, or similarities among observations. |
m2 |
a second numeric matrix giving another measure of pairwise distances, correlations, or similarities among observations. |
nperm |
the number of times to permute the data. |
graph |
a logical indicating whether to produce a summary graph (by default the graph is not plotted). |
alternative |
a character string defining the alternative
hypothesis: |
... |
further arguments to be passed to |
The function calculates a -statistic for the Mantel test, equal to
the sum of the pairwise product of the lower triangles of the
permuted matrices, for each permutation of rows and columns. It
compares the permuted distribution with the -statistic observed
for the actual data.
The present implementation can analyse symmetric as well as (since version 5.1 of ape) asymmetric matrices (see Mantel 1967, Sects. 4 and 5). The diagonals of both matrices are ignored.
If graph = TRUE, the functions plots the density estimate of
the permutation distribution along with the observed -statistic
as a vertical line.
The ... argument allows the user to give further options to
the plot function: the title main be changed with main=,
the axis labels with xlab =, and ylab =, and so on.
z.stat |
the |
p |
|
alternative |
the alternative hypothesis. |
Original code in S by Ben Bolker, ported to R by Julien Claude
Mantel, N. (1967) The detection of disease clustering and a generalized regression approach. Cancer Research, 27, 209–220.
Manly, B. F. J. (1986) Multivariate statistical methods: a primer. London: Chapman & Hall.
q1 <- matrix(runif(36), nrow = 6) q2 <- matrix(runif(36), nrow = 6) diag(q1) <- diag(q2) <- 0 mantel.test(q1, q2, graph = TRUE, main = "Mantel test: a random example with 6 X 6 matrices representing asymmetric relationships", xlab = "z-statistic", ylab = "Density", sub = "The vertical line shows the observed z-statistic")q1 <- matrix(runif(36), nrow = 6) q2 <- matrix(runif(36), nrow = 6) diag(q1) <- diag(q2) <- 0 mantel.test(q1, q2, graph = TRUE, main = "Mantel test: a random example with 6 X 6 matrices representing asymmetric relationships", xlab = "z-statistic", ylab = "Density", sub = "The vertical line shows the observed z-statistic")
Three matrices respectively representing Serological (asymmetric), DNA hybridization (asymmetric) and Anatomical (symmetric) distances among 9 families.
data(mat3)data(mat3)
A data frame with 27 observations and 9 variables.
Lapointe, F.-J., J. A. W. Kirsch and J. M. Hutcheon. 1999. Total evidence, consensus, and bat phylogeny: a distance-based approach. Molecular Phylogenetics and Evolution 11: 55-66.
Three partly similar trees, two independent trees.
data(mat5M3ID)data(mat5M3ID)
A data frame with 250 observations and 50 variables.
Data provided by V. Campbell.
Five independent additive trees.
data(mat5Mrand)data(mat5Mrand)
A data frame with 250 observations and 50 variables.
Data provided by V. Campbell.
This function computes the exponential of a square matrix using a spectral decomposition.
matexpo(x)matexpo(x)
x |
a square matrix of mode numeric. |
a numeric matrix of the same dimensions than ‘x’.
Emmanuel Paradis
### a simple rate matrix: m <- matrix(0.1, 4, 4) diag(m) <- -0.3 ### towards equilibrium: for (t in c(1, 5, 10, 50)) print(matexpo(m*t))### a simple rate matrix: m <- matrix(0.1, 4, 4) diag(m) <- -0.3 ### towards equilibrium: for (t in c(1, 5, 10, 50)) print(matexpo(m*t))
This function performs the McConway–Sims test that a trait or variable does not affect diversification rate.
mcconwaysims.test(x)mcconwaysims.test(x)
x |
a matrix or a data frame with at least two columns: the first one gives the number of species in clades with a trait supposed to increase or decrease diversification rate, and the second one the number of species in the sister-clades without the trait. Each row represents a pair of sister-clades. |
The McConway–Sims test compares a series of sister-clades where one of the two is characterized by a trait supposed to affect diversification rate. The null hypothesis is that the trait does not affect diversification. The alternative hypothesis is that diversification rate is increased or decreased by the trait (by contrast to the Slowinski–Guyer test). The test is a likelihood-ratio of a null Yule model and an alternative model with two parameters.
a data frame with the , the number of degrees of
freedom, and the P-value.
Emmanuel Paradis
McConway, K. J. and Sims, H. J. (2004) A likelihood-based method for testing for nonstochastic variation of diversification rates in phylogenies. Evolution, 58, 12–23.
Paradis, E. (2012) Shift in diversification in sister-clade comparisons: a more powerful test. Evolution, 66, 288–295.
balance, slowinskiguyer.test,
rc in geiger, shift.test in apTreeshape
### simulate 10 clades with lambda = 0.1 and mu = 0.09: n0 <- replicate(10, balance(rbdtree(.1, .09, Tmax = 35))[1]) ### simulate 10 clades with lambda = 0.15 and mu = 0.1: n1 <- replicate(10, balance(rbdtree(.15, .1, Tmax = 35))[1]) x <- cbind(n1, n0) mcconwaysims.test(x) slowinskiguyer.test(x) richness.yule.test(x, 35)### simulate 10 clades with lambda = 0.1 and mu = 0.09: n0 <- replicate(10, balance(rbdtree(.1, .09, Tmax = 35))[1]) ### simulate 10 clades with lambda = 0.15 and mu = 0.1: n1 <- replicate(10, balance(rbdtree(.15, .1, Tmax = 35))[1]) x <- cbind(n1, n0) mcconwaysims.test(x) slowinskiguyer.test(x) richness.yule.test(x, 35)
These functions implement a reversible jump MCMC framework to infer the demographic history,
as well as corresponding confidence bands,
from a genealogical tree. The computed demographic history is a continous
and smooth function in time.
mcmc.popsize runs the actual MCMC chain and outputs information about the
sampling steps, extract.popsize generates from this MCMC
output a table of population size in time, and plot.popsize and lines.popsize
provide utility functions to plot the corresponding demographic functions.
mcmc.popsize(tree,nstep, thinning=1, burn.in=0,progress.bar=TRUE, method.prior.changepoints=c("hierarchical", "fixed.lambda"), max.nodes=30, lambda=0.5, gamma.shape=0.5, gamma.scale=2, method.prior.heights=c("skyline", "constant", "custom"), prior.height.mean, prior.height.var) extract.popsize(mcmc.out, credible.interval=0.95, time.points=200, thinning=1, burn.in=0) ## S3 method for class 'popsize' plot(x, show.median=TRUE, show.years=FALSE, subst.rate, present.year, xlab = NULL, ylab = "Effective population size", log = "y", ...) ## S3 method for class 'popsize' lines(x, show.median=TRUE,show.years=FALSE, subst.rate, present.year, ...)mcmc.popsize(tree,nstep, thinning=1, burn.in=0,progress.bar=TRUE, method.prior.changepoints=c("hierarchical", "fixed.lambda"), max.nodes=30, lambda=0.5, gamma.shape=0.5, gamma.scale=2, method.prior.heights=c("skyline", "constant", "custom"), prior.height.mean, prior.height.var) extract.popsize(mcmc.out, credible.interval=0.95, time.points=200, thinning=1, burn.in=0) ## S3 method for class 'popsize' plot(x, show.median=TRUE, show.years=FALSE, subst.rate, present.year, xlab = NULL, ylab = "Effective population size", log = "y", ...) ## S3 method for class 'popsize' lines(x, show.median=TRUE,show.years=FALSE, subst.rate, present.year, ...)
tree |
Either an ultrametric tree (i.e. an object of class |
nstep |
Number of MCMC steps, i.e. length of the Markov chain (suggested value: 10,000-50,000). |
thinning |
Thinning factor (suggest value: 10-100). |
burn.in |
Number of steps dropped from the chain to allow for a burn-in phase (suggest value: 1000). |
progress.bar |
Show progress bar during the MCMC run. |
method.prior.changepoints |
If |
max.nodes |
Upper limit for the number of internal nodes of the approximating spline (default: 30). |
lambda |
Smoothing parameter. For |
gamma.shape |
Shape parameter of the gamma function from which |
gamma.scale |
Scale parameter of the gamma function from which |
method.prior.heights |
Determines the prior for the heights of the change points.
If |
prior.height.mean |
Function describing the mean of the prior distribution for the heights
(only used if |
prior.height.var |
Function describing the variance of the prior distribution for the heights
(only used if |
mcmc.out |
Output from |
credible.interval |
Probability mass of the confidence band (default: 0.95). |
time.points |
Number of discrete time points in the table output by |
x |
Table with population size versus time, as computed by |
show.median |
Plot median rather than mean as point estimate for demographic function (default: TRUE). |
show.years |
Option that determines whether the time is plotted in units of of substitutions (default) or in years (requires specification of substution rate and year of present). |
subst.rate |
Substitution rate (see option show.years). |
present.year |
Present year (see option show.years). |
xlab |
label on the x-axis (depends on the value of
|
ylab |
label on the y-axis. |
log |
log-transformation of axes; by default, the y-axis is log-transformed. |
... |
Further arguments to be passed on to |
Please refer to Opgen-Rhein et al. (2005) for methodological details, and the help page of
skyline for information on a related approach.
Rainer Opgen-Rhein and Korbinian Strimmer. Parts of the rjMCMC sampling procedure are adapted from R code by Karl Broman.
Opgen-Rhein, R., Fahrmeir, L. and Strimmer, K. 2005. Inference of demographic history from genealogical trees using reversible jump Markov chain Monte Carlo. BMC Evolutionary Biology, 5, 6.
skyline and skylineplot.
# get tree data("hivtree.newick") # example tree in NH format tree.hiv <- read.tree(text = hivtree.newick) # load tree # run mcmc chain mcmc.out <- mcmc.popsize(tree.hiv, nstep=100, thinning=1, burn.in=0,progress.bar=FALSE) # toy run #mcmc.out <- mcmc.popsize(tree.hiv, nstep=10000, thinning=5, burn.in=500) # remove comments!! # make list of population size versus time popsize <- extract.popsize(mcmc.out) # plot and compare with skyline plot sk <- skyline(tree.hiv) plot(sk, lwd=1, lty=3, show.years=TRUE, subst.rate=0.0023, present.year = 1997) lines(popsize, show.years=TRUE, subst.rate=0.0023, present.year = 1997)# get tree data("hivtree.newick") # example tree in NH format tree.hiv <- read.tree(text = hivtree.newick) # load tree # run mcmc chain mcmc.out <- mcmc.popsize(tree.hiv, nstep=100, thinning=1, burn.in=0,progress.bar=FALSE) # toy run #mcmc.out <- mcmc.popsize(tree.hiv, nstep=10000, thinning=5, burn.in=500) # remove comments!! # make list of population size versus time popsize <- extract.popsize(mcmc.out) # plot and compare with skyline plot sk <- skyline(tree.hiv) plot(sk, lwd=1, lty=3, show.years=TRUE, subst.rate=0.0023, present.year = 1997) lines(popsize, show.years=TRUE, subst.rate=0.0023, present.year = 1997)
This function helps to format labels with parts of text in different font shapes (italics, bold, or bolditalics) and different separators. The output is intended to be used for plotting.
mixedFontLabel(..., sep = " ", italic = NULL, bold = NULL, parenthesis = NULL, always.upright = c("sp.", "spp.", "ssp."))mixedFontLabel(..., sep = " ", italic = NULL, bold = NULL, parenthesis = NULL, always.upright = c("sp.", "spp.", "ssp."))
... |
vectors of mode character to be formatted. They may be of different lengths in which case the shortest ones are recycled. |
sep |
a vector of mode character giving the separators to be
printed between the elements in |
italic |
a vector of integers specifying the elements in
|
bold |
id. in boldface. |
parenthesis |
id. within parentheses. |
always.upright |
of vector of mode character giving the strings
to not print in italics. Use |
The idea is to have different bits of text in different vectors that
are put together to make a vector of R expressions. This vector is
interpreted by graphical functions to format the text. A simple use
may be mixedFontLabel(genus, species, italic = 1:2), but it is
more interesting when mixing fonts (see examples).
To have an element in bolditalics, its number must given in both
italic and bold.
The vector returned by this function may be assigned as the
tip.label element of a tree of class "phylo", or even as
its node.label element.
A vector of mode expression.
Emmanuel Paradis
makeLabel, makeNodeLabel,
label2table, updateLabel,
checkLabel
tr <- read.tree(text = "((a,(b,c)),d);") genus <- c("Gorilla", "Pan", "Homo", "Pongo") species <- c("gorilla", "spp.", "sapiens", "pygmaeus") geo <- c("Africa", "Africa", "World", "Asia") tr$tip.label <- mixedFontLabel(genus, species, geo, italic = 1:2, parenthesis = 3) layout(matrix(c(1, 2), 2)) plot(tr) tr$tip.label <- mixedFontLabel(genus, species, geo, sep = c(" ", " | "), italic = 1:2, bold = 3) plot(tr) layout(1)tr <- read.tree(text = "((a,(b,c)),d);") genus <- c("Gorilla", "Pan", "Homo", "Pongo") species <- c("gorilla", "spp.", "sapiens", "pygmaeus") geo <- c("Africa", "Africa", "World", "Asia") tr$tip.label <- mixedFontLabel(genus, species, geo, italic = 1:2, parenthesis = 3) layout(matrix(c(1, 2), 2)) plot(tr) tr$tip.label <- mixedFontLabel(genus, species, geo, sep = c(" ", " | "), italic = 1:2, bold = 3) plot(tr) layout(1)
This function computes Moran's I autocorrelation coefficient of
x giving a matrix of weights using the method described by
Gittleman and Kot (1990).
Moran.I(x, weight, scaled = FALSE, na.rm = FALSE, alternative = "two.sided")Moran.I(x, weight, scaled = FALSE, na.rm = FALSE, alternative = "two.sided")
x |
a numeric vector. |
weight |
a matrix of weights. |
scaled |
a logical indicating whether the coefficient should be
scaled so that it varies between -1 and +1 (default to
|
na.rm |
a logical indicating whether missing values should be removed. |
alternative |
a character string specifying the alternative hypothesis that is tested against the null hypothesis of no phylogenetic correlation; must be of one "two.sided", "less", or "greater", or any unambiguous abbrevation of these. |
The matrix weight is used as “neighbourhood” weights, and
Moran's I coefficient is computed using the formula:
with
= observations
= distance weight
= number of observations
=
The null hypothesis of no phylogenetic correlation is tested assuming
normality of I under this null hypothesis. If the observed value
of I is significantly greater than the expected value, then the values
of x are positively autocorrelated, whereas if Iobserved <
Iexpected, this will indicate negative autocorrelation.
A list containing the elements:
observed |
the computed Moran's I. |
expected |
the expected value of I under the null hypothesis. |
sd |
the standard deviation of I under the null hypothesis. |
p.value |
the P-value of the test of the null hypothesis against
the alternative hypothesis specified in |
Julien Dutheil [email protected] and Emmanuel Paradis
Gittleman, J. L. and Kot, M. (1990) Adaptation: statistics and a null model for estimating phylogenetic effects. Systematic Zoology, 39, 227–241.
tr <- rtree(30) x <- rnorm(30) ## weights w[i,j] = 1/d[i,j]: w <- 1/cophenetic(tr) ## set the diagonal w[i,i] = 0 (instead of Inf...): diag(w) <- 0 Moran.I(x, w) Moran.I(x, w, alt = "l") Moran.I(x, w, alt = "g") Moran.I(x, w, scaled = TRUE) # usualy the sametr <- rtree(30) x <- rnorm(30) ## weights w[i,j] = 1/d[i,j]: w <- 1/cophenetic(tr) ## set the diagonal w[i,i] = 0 (instead of Inf...): diag(w) <- 0 Moran.I(x, w) Moran.I(x, w, alt = "l") Moran.I(x, w, alt = "g") Moran.I(x, w, scaled = TRUE) # usualy the same
This function does ancestral character reconstruction by parsimony as described in Hanazawa et al. (1995) and modified by Narushima and Hanazawa (1997).
MPR(x, phy, outgroup)MPR(x, phy, outgroup)
x |
a vector of integers. |
phy |
an object of class |
outgroup |
an integer or a character string giving the tip of
|
Hanazawa et al. (1995) and Narushima and Hanazawa (1997) used Farris's (1970) and Swofford and Maddison's (1987) framework to reconstruct ancestral states using parsimony. The character is assumed to take integer values. The algorithm finds the sets of values for each node as intervals with lower and upper values.
It is recommended to root the tree with the outgroup before the
analysis, so plotting the values with nodelabels is
simple.
a matrix of integers with two columns named “lower” and “upper” giving the lower and upper values of the reconstructed sets for each node.
Emmanuel Paradis
Farris, J. M. (1970) Methods for computing Wagner trees. Systematic Zoology, 19, 83–92.
Hanazawa, M., Narushima, H. and Minaka, N. (1995) Generating most parsimonious reconstructions on a tree: a generalization of the Farris–Swofford–Maddison method. Discrete Applied Mathematics, 56, 245–265.
Narushima, H. and Hanazawa, M. (1997) A more efficient algorithm for MPR problems in phylogeny. Discrete Applied Mathematics, 80, 231–238.
Swofford, D. L. and Maddison, W. P. (1987) Reconstructing ancestral character states under Wagner parsimony. Mathematical Biosciences, 87, 199–229.
## the example in Narushima and Hanazawa (1997): tr <- read.tree(text = "(((i,j)c,(k,l)b)a,(h,g)e,f)d;") x <- c(1, 3, 0, 6, 5, 2, 4) names(x) <- letters[6:12] (o <- MPR(x, tr, "f")) plot(tr) nodelabels(paste0("[", o[, 1], ",", o[, 2], "]")) tiplabels(x[tr$tip.label], adj = -2) ## some random data: x <- rpois(30, 1) tr <- rtree(30, rooted = FALSE) MPR(x, tr, "t1")## the example in Narushima and Hanazawa (1997): tr <- read.tree(text = "(((i,j)c,(k,l)b)a,(h,g)e,f)d;") x <- c(1, 3, 0, 6, 5, 2, 4) names(x) <- letters[6:12] (o <- MPR(x, tr, "f")) plot(tr) nodelabels(paste0("[", o[, 1], ",", o[, 2], "]")) tiplabels(x[tr$tip.label], adj = -2) ## some random data: x <- rpois(30, 1) tr <- rtree(30, rooted = FALSE) MPR(x, tr, "t1")
mrca returns for each pair of tips (and nodes) its most
recent common ancestor (MRCA).
getMRCA returns the MRCA of two or more tips.
mrca(phy, full = FALSE) getMRCA(phy, tip)mrca(phy, full = FALSE) getMRCA(phy, tip)
phy |
an object of class |
full |
a logical indicating whether to return the MRCAs among
all tips and nodes (if |
tip |
a vector of mode numeric or character specifying the tips; can also be node numbers. |
For mrca, the diagonal is set to the number of the tips (and
nodes if full = TRUE). If full = FALSE, the colnames and
rownames are set with the tip labels of the tree; otherwise the
numbers are given as names.
For getMRCA, if tip is of length one or zero then
NULL is returned.
a matrix of mode numeric (mrca) or a single numeric value
(getMRCA).
Emmanuel Paradis, Klaus Schliep, Joseph W. Brown
The function mst finds the minimum spanning tree between a set of
observations using a matrix of pairwise distances.
The plot method plots the minimum spanning tree showing the
links where the observations are identified by their numbers.
mst(X) ## S3 method for class 'mst' plot(x, graph = "circle", x1 = NULL, x2 = NULL, ...)mst(X) ## S3 method for class 'mst' plot(x, graph = "circle", x1 = NULL, x2 = NULL, ...)
X |
either a matrix that can be interpreted as a distance matrix,
or an object of class |
x |
an object of class |
graph |
a character string indicating the type of graph to plot
the minimum spanning tree; two choices are possible: |
x1 |
a numeric vector giving the coordinates of the observations
on the x-axis. Both |
x2 |
a numeric vector giving the coordinates of the observations
on the y-axis. Both |
... |
further arguments to be passed to |
These functions provide two ways to plot the minimum spanning tree which
try to space as much as possible the observations in order to show as
clearly as possible the links. The option graph = "circle"
simply plots regularly the observations on a circle, whereas
graph = "nsca" uses a non-symmetric correspondence analysis
where each observation is represented at the centroid of its neighbours.
Alternatively, the user may use any system of coordinates for the obsevations, for instance a principal components analysis (PCA) if the distances were computed from an original matrix of continous variables.
an object of class "mst" which is a square numeric matrix of size
equal to the number of observations with either 1 if a link
between the corresponding observations was found, or 0
otherwise. The names of the rows and columns of the distance matrix,
if available, are given as rownames and colnames to the returned object.
Yvonnick Noel [email protected], Julien Claude [email protected] and Emmanuel Paradis
dist.dna, dist.gene,
dist, plot
The package pegas has a more efficient implementation of the MST
(see ?rmst) and plotting methods for haplotypes networks.
require(stats) X <- matrix(runif(200), 20, 10) d <- dist(X) PC <- prcomp(X) M <- mst(d) opar <- par(mfcol = c(2, 2)) plot(M) plot(M, graph = "nsca") plot(M, x1 = PC$x[, 1], x2 = PC$x[, 2]) par(opar)require(stats) X <- matrix(runif(200), 20, 10) d <- dist(X) PC <- prcomp(X) M <- mst(d) opar <- par(mfcol = c(2, 2)) plot(M) plot(M, graph = "nsca") plot(M, x1 = PC$x[, 1], x2 = PC$x[, 2]) par(opar)
These two functions collapse or resolve multichotomies in phylogenetic trees.
multi2di(phy, ...) ## S3 method for class 'phylo' multi2di(phy, random = TRUE, equiprob = TRUE, ...) ## S3 method for class 'multiPhylo' multi2di(phy, random = TRUE, equiprob = TRUE, ...) di2multi(phy, ...) ## S3 method for class 'phylo' di2multi(phy, tol = 1e-08, ...) ## S3 method for class 'multiPhylo' di2multi(phy, tol = 1e-08, ...)multi2di(phy, ...) ## S3 method for class 'phylo' multi2di(phy, random = TRUE, equiprob = TRUE, ...) ## S3 method for class 'multiPhylo' multi2di(phy, random = TRUE, equiprob = TRUE, ...) di2multi(phy, ...) ## S3 method for class 'phylo' di2multi(phy, tol = 1e-08, ...) ## S3 method for class 'multiPhylo' di2multi(phy, tol = 1e-08, ...)
phy |
an object of class |
random |
a logical value specifying whether to resolve the
multichotomies randomly (the default) or in the order they appear in
the tree (if |
equiprob |
a logical value: should topologies generated in equal
probabilities; see details in |
tol |
a numeric value giving the tolerance to consider a branch length significantly greater than zero. |
... |
arguments passed among methods. |
multi2di transforms all multichotomies into a series of
dichotomies with one (or several) branch(es) of length zero.
di2multi deletes all branches smaller than tol and
collapses the corresponding dichotomies into a multichotomy.
an object of the same class than the input.
Emmanuel Paradis
data(bird.families) is.binary(bird.families) is.binary(multi2di(bird.families)) all.equal(di2multi(multi2di(bird.families)), bird.families) ### To see the results of randomly resolving a trichotomy: tr <- read.tree(text = "(a:1,b:1,c:1);") layout(matrix(1:4, 2, 2)) for (i in 1:4) plot(multi2di(tr), use.edge.length = FALSE, cex = 1.5) layout(1)data(bird.families) is.binary(bird.families) is.binary(multi2di(bird.families)) all.equal(di2multi(multi2di(bird.families)), bird.families) ### To see the results of randomly resolving a trichotomy: tr <- read.tree(text = "(a:1,b:1,c:1);") layout(matrix(1:4, 2, 2)) for (i in 1:4) plot(multi2di(tr), use.edge.length = FALSE, cex = 1.5) layout(1)
These are extraction and replacement operators for lists of trees
stored in the class "multiPhylo".
## S3 method for class 'multiPhylo' x[i] ## S3 method for class 'multiPhylo' x[[i]] ## S3 method for class 'multiPhylo' x$name ## S3 replacement method for class 'multiPhylo' x[i] <- value ## S3 replacement method for class 'multiPhylo' x[[i]] <- value ## S3 replacement method for class 'multiPhylo' x$i <- value## S3 method for class 'multiPhylo' x[i] ## S3 method for class 'multiPhylo' x[[i]] ## S3 method for class 'multiPhylo' x$name ## S3 replacement method for class 'multiPhylo' x[i] <- value ## S3 replacement method for class 'multiPhylo' x[[i]] <- value ## S3 replacement method for class 'multiPhylo' x$i <- value
x, value
|
an object of class |
i |
index(ices) of the tree(s) to select from a list; this may be a vector of integers, logicals, or names. |
name |
a character string specifying the tree to be extracted. |
The subsetting operator [ keeps the class correctly
("multiPhylo").
The replacement operators check the labels of value if x
has a single vector of tip labels for all trees (see examples).
An object of class "phylo" ([[, $) or of class
"multiPhylo" ([ and the replacement operators).
Emmanuel Paradis
x <- rmtree(10, 20) names(x) <- paste("tree", 1:10, sep = "") x[1:5] x[1] # subsetting x[[1]] # extraction x$tree1 # same than above x[[1]] <- rtree(20) y <- .compressTipLabel(x) ## up to here 'x' and 'y' have exactly the same information ## but 'y' has a unique vector of tip labels for all the trees x[[1]] <- rtree(10) # no error try(y[[1]] <- rtree(10)) # error try(x[1] <- rtree(20)) # error ## use instead one of the two: x[1] <- list(rtree(20)) x[1] <- c(rtree(20)) x[1:5] <- rmtree(5, 20) # replacement x[11:20] <- rmtree(10, 20) # elongation x # 20 treesx <- rmtree(10, 20) names(x) <- paste("tree", 1:10, sep = "") x[1:5] x[1] # subsetting x[[1]] # extraction x$tree1 # same than above x[[1]] <- rtree(20) y <- .compressTipLabel(x) ## up to here 'x' and 'y' have exactly the same information ## but 'y' has a unique vector of tip labels for all the trees x[[1]] <- rtree(10) # no error try(y[[1]] <- rtree(10)) # error try(x[1] <- rtree(20)) # error ## use instead one of the two: x[1] <- list(rtree(20)) x[1] <- c(rtree(20)) x[1:5] <- rmtree(5, 20) # replacement x[11:20] <- rmtree(10, 20) # elongation x # 20 trees
Phylogenetic tree construction based on the minimum variance reduction.
mvr(X, V) mvrs(X, V, fs = 15)mvr(X, V) mvrs(X, V, fs = 15)
X |
a distance matrix. |
V |
a variance matrix. |
fs |
agglomeration criterion parameter: it is coerced as an integer and must at least equal to one. |
The MVR method can be seen as a version of BIONJ which is not restricted to the Poison model of variance (Gascuel 2000).
an object of class "phylo".
Andrei Popescu
Criscuolo, A. and Gascuel, O. (2008). Fast NJ-like algorithms to deal with incomplete distance matrices. BMC Bioinformatics, 9.
Gascuel, O. (2000). Data model and classification by trees: the minimum variance reduction (MVR) method. Journal of Classification, 17, 67–99.
data(woodmouse) rt <- dist.dna(woodmouse, variance = TRUE) v <- attr(rt, "variance") tr <- mvr(rt, v) plot(tr, "u")data(woodmouse) rt <- dist.dna(woodmouse, variance = TRUE) v <- attr(rt, "variance") tr <- mvr(rt, v) plot(tr, "u")
This function performs the neighbor-joining tree estimation of Saitou and Nei (1987).
nj(X)nj(X)
X |
a distance matrix; may be an object of class “dist”. |
an object of class "phylo".
Emmanuel Paradis
Saitou, N. and Nei, M. (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4, 406–425.
Studier, J. A. and Keppler, K. J. (1988) A note on the neighbor-joining algorithm of Saitou and Nei. Molecular Biology and Evolution, 5, 729–731.
write.tree, read.tree,
dist.dna, bionj,
fastme, njs
### From Saitou and Nei (1987, Table 1): x <- c(7, 8, 11, 13, 16, 13, 17, 5, 8, 10, 13, 10, 14, 5, 7, 10, 7, 11, 8, 11, 8, 12, 5, 6, 10, 9, 13, 8) M <- matrix(0, 8, 8) M[lower.tri(M)] <- x M <- t(M) M[lower.tri(M)] <- x dimnames(M) <- list(1:8, 1:8) tr <- nj(M) plot(tr, "u") ### a less theoretical example data(woodmouse) trw <- nj(dist.dna(woodmouse)) plot(trw)### From Saitou and Nei (1987, Table 1): x <- c(7, 8, 11, 13, 16, 13, 17, 5, 8, 10, 13, 10, 14, 5, 7, 10, 7, 11, 8, 11, 8, 12, 5, 6, 10, 9, 13, 8) M <- matrix(0, 8, 8) M[lower.tri(M)] <- x M <- t(M) M[lower.tri(M)] <- x dimnames(M) <- list(1:8, 1:8) tr <- nj(M) plot(tr, "u") ### a less theoretical example data(woodmouse) trw <- nj(dist.dna(woodmouse)) plot(trw)
Reconstructs a phylogenetic tree from a distance matrix with possibly missing values.
njs(X, fs = 15) bionjs(X, fs = 15)njs(X, fs = 15) bionjs(X, fs = 15)
X |
a distance matrix. |
fs |
argument s of the agglomerative criterion: it is coerced as an integer and must at least equal to one. |
Missing values represented by either NA or any negative number.
Basically, the Q* criterion is applied to all the pairs of leaves, and the s highest scoring ones are chosen for further analysis by the agglomeration criteria that better handle missing distances (see references for details).
an object of class "phylo".
Andrei Popescu
Criscuolo, A., Gascuel, O. (2008) Fast NJ-like algorithms to deal with incomplete distance matrices. BMC Bioinformatics, 9, 166.
data(woodmouse) d <- dist.dna(woodmouse) dm <- d dm[sample(length(dm), size = 3)] <- NA dist.topo(njs(dm), nj(d)) # often 0 dm[sample(length(dm), size = 10)] <- NA dist.topo(njs(dm), nj(d)) # sometimes 0data(woodmouse) d <- dist.dna(woodmouse) dm <- d dm[sample(length(dm), size = 3)] <- NA dist.topo(njs(dm), nj(d)) # often 0 dm[sample(length(dm), size = 10)] <- NA dist.topo(njs(dm), nj(d)) # sometimes 0
Estimate the dates of a rooted phylogenetic tree from the tip dates.
estimate.mu(t, node.dates, p.tol = 0.05) estimate.dates(t, node.dates, mu = estimate.mu(t, node.dates), min.date = -.Machine$double.xmax, show.steps = 0, opt.tol = 1e-8, nsteps = 1000, lik.tol = 0, is.binary = is.binary.phylo(t))estimate.mu(t, node.dates, p.tol = 0.05) estimate.dates(t, node.dates, mu = estimate.mu(t, node.dates), min.date = -.Machine$double.xmax, show.steps = 0, opt.tol = 1e-8, nsteps = 1000, lik.tol = 0, is.binary = is.binary.phylo(t))
t |
an object of class "phylo" |
node.dates |
a numeric vector of dates for the tips, in the same order as 't$tip.label' or a vector of dates for all of the nodes. |
p.tol |
p-value cutoff for failed regression. |
mu |
mutation rate. |
min.date |
the minimum bound on the dates of nodes |
show.steps |
print the log likelihood every show.steps. If 0 will supress output. |
opt.tol |
tolerance for optimization precision. |
lik.tol |
tolerance for likelihood comparison. |
nsteps |
the maximum number of steps to run. |
is.binary |
if TRUE, will run a faster optimization method that only works if the tree is binary; otherwise will use optimize() as the optimization method. |
This code duplicates the functionality of the program Tip.Dates (see references). The dates of the internal nodes of 't' are estimated using a maximum likelihood approach.
't' must be rooted and have branch lengths in units of expected substitutions per site.
'node.dates' can be either a numeric vector of dates for the tips or a numeric vector for all of the nodes of 't'. 'estimate.mu' will use all of the values given in 'node.dates' to estimate the mutation rate. Dates can be censored with NA. 'node.dates' must contain all of the tip dates when it is a parameter of 'estimate.dates'. If only tip dates are given, then 'estimate.dates' will run an initial step to estimate the dates of the internal nodes. If 'node.dates' contains dates for some of the nodes, 'estimate.dates' will use those dates as priors in the inital step. If all of the dates for nodes are given, then 'estimate.dates' will not run the inital step.
If 'is.binary' is set to FALSE, 'estimate.dates' uses the "optimize" function as the optimization method. By default, R's "optimize" function uses a precision of ".Machine$double.eps^0.25", which is about 0.0001 on a 64-bit system. This should be set to a smaller value if the branch lengths of 't' are very short. If 'is.binary' is set to TRUE, estimate dates uses calculus to deterimine the maximum likelihood at each step, which is faster. The bounds of permissible values are reduced by 'opt.tol'.
'estimate.dates' has several criteria to decide how many steps it will run. If 'lik.tol' and 'nsteps' are both 0, then 'estimate.dates' will only run the initial step. If 'lik.tol' is greater than 0 and 'nsteps' is 0, then 'estimate.dates' will run until the difference between successive steps is less than 'lik.tol'. If 'lik.tol' is 0 and 'nsteps' is greater than 0, then 'estimate.dates' will run the inital step and then 'nsteps' steps. If 'lik.tol' and 'nsteps' are both greater than 0, then 'estimate.dates' will run the inital step and then either 'nsteps' steps or until the difference between successive steps is less than 'lik.tol'.
The estimated mutation rate as a numeric vector of length one for estimate.mu.
The estimated dates of all of the nodes of the tree as a numeric vector with length equal to the number of nodes in the tree.
This model assumes that the tree follows a molecular clock. It only performs a rudimentary statistical test of the molecular clock hypothesis.
Bradley R. Jones <email: [email protected]>
Felsenstein, J. (1981) Evolutionary trees from DNA sequences: a maximum likelihood approach. Journal of Molecular Evolution, 17, 368–376.
Rambaut, A. (2000) Estimating the rate of molecular evolution: incorporating non-contemporaneous sequences into maximum likelihood phylogenies. Bioinformatics, 16, 395–399.
Jones, Bradley R., and Poon, Art F. Y. (2016) node.dating: dating ancestors in phylogenetic trees in R Bioinformatics, 33, 932–934.
t <- rtree(100) tip.date <- rnorm(t$tip.label, mean = node.depth.edgelength(t)[1:Ntip(t)])^2 t <- rtt(t, tip.date) mu <- estimate.mu(t, tip.date) ## Run for 100 steps node.date <- estimate.dates(t, tip.date, mu, nsteps = 100) ## Run until the difference between successive log likelihoods is ## less than $10^{-4}$ starting with the 100th step's results node.date <- estimate.dates(t, node.date, mu, nsteps = 0, lik.tol = 1e-4) ## To rescale the tree over time t$edge.length <- node.date[t$edge[, 2]] - node.date[t$edge[, 1]]t <- rtree(100) tip.date <- rnorm(t$tip.label, mean = node.depth.edgelength(t)[1:Ntip(t)])^2 t <- rtt(t, tip.date) mu <- estimate.mu(t, tip.date) ## Run for 100 steps node.date <- estimate.dates(t, tip.date, mu, nsteps = 100) ## Run until the difference between successive log likelihoods is ## less than $10^{-4}$ starting with the 100th step's results node.date <- estimate.dates(t, node.date, mu, nsteps = 0, lik.tol = 1e-4) ## To rescale the tree over time t$edge.length <- node.date[t$edge[, 2]] - node.date[t$edge[, 1]]
These functions return the depths or heights of nodes and tips.
node.depth(phy, method = 1) node.depth.edgelength(phy) node.height(phy, clado.style = FALSE)node.depth(phy, method = 1) node.depth.edgelength(phy) node.height(phy, clado.style = FALSE)
phy |
an object of class "phylo". |
method |
an integer value (1 or 2); 1: the node depths are proportional to the number of tips descending from each node, 2: they are evenly spaced. |
clado.style |
a logical value; if |
node.depth computes the depth of a node depending on the value
of method (see the option node.depth in
plot.phylo). The value of 1 is given to the tips.
node.depth.edgelength does the same but using branch lengths.
node.height computes the heights of nodes and tips as plotted
by a phylogram or a cladogram.
A numeric vector indexed with the node numbers of the matrix ‘edge’ of
phy.
Emmanuel Paradis
These functions add labels to or near the nodes, the tips, or the edges of a tree using text or plotting symbols. The text can be framed.
nodelabels(text, node, adj = c(0.5, 0.5), frame = "rect", pch = NULL, thermo = NULL, pie = NULL, piecol = NULL, col = "black", bg = "lightblue", horiz = FALSE, width = NULL, height = NULL, ...) tiplabels(text, tip, adj = c(0.5, 0.5), frame = "rect", pch = NULL, thermo = NULL, pie = NULL, piecol = NULL, col = "black", bg = "yellow", horiz = FALSE, width = NULL, height = NULL, offset = 0, ...) edgelabels(text, edge, adj = c(0.5, 0.5), frame = "rect", pch = NULL, thermo = NULL, pie = NULL, piecol = NULL, col = "black", bg = "lightgreen", horiz = FALSE, width = NULL, height = NULL, date = NULL, ...)nodelabels(text, node, adj = c(0.5, 0.5), frame = "rect", pch = NULL, thermo = NULL, pie = NULL, piecol = NULL, col = "black", bg = "lightblue", horiz = FALSE, width = NULL, height = NULL, ...) tiplabels(text, tip, adj = c(0.5, 0.5), frame = "rect", pch = NULL, thermo = NULL, pie = NULL, piecol = NULL, col = "black", bg = "yellow", horiz = FALSE, width = NULL, height = NULL, offset = 0, ...) edgelabels(text, edge, adj = c(0.5, 0.5), frame = "rect", pch = NULL, thermo = NULL, pie = NULL, piecol = NULL, col = "black", bg = "lightgreen", horiz = FALSE, width = NULL, height = NULL, date = NULL, ...)
text |
a vector of mode character giving the text to be printed. Can be left empty. |
node |
a vector of mode numeric giving the numbers of the nodes where the text or the symbols are to be printed. Can be left empty. |
tip |
a vector of mode numeric giving the numbers of the tips where the text or the symbols are to be printed. Can be left empty. |
edge |
a vector of mode numeric giving the numbers of the edges where the text or the symbols are to be printed. Can be left empty. |
adj |
one or two numeric values specifying the horizontal and vertical, respectively, justification of the text or symbols. By default, the text is centered horizontally and vertically. If a single value is given, this alters only the horizontal position of the text. |
frame |
a character string specifying the kind of frame to be printed around the text. This must be one of "rect" (the default), "circle", "none", or any unambiguous abbreviation of these. |
pch |
a numeric giving the type of plotting symbol to be used;
this is eventually recycled. See |
thermo |
a numeric vector giving some proportions (values between 0 and 1) for each node, or a numeric matrix giving some proportions (the rows must sum to one). It can be a data frame which is then converted into a matrix. |
pie |
same than |
piecol |
a list of colours (given as a character vector) to be
used by |
col |
a character string giving the color to be used for the text or the plotting symbols; this is eventually recycled. |
bg |
a character string giving the color to be used for the background of the text frames or of the plotting symbols if it applies; this is eventually recycled. |
... |
further arguments passed to the |
horiz, width, height
|
parameters controlling the aspect of thermometers; by default, their width and height are determined automatically. |
offset |
offset of the tip labels (can be negative). |
date |
specifies the positions of labels on edges of chronograms with respect to the time scale. |
These three functions have the same optional arguments and the same functioning.
If the arguments text is missing and pch and
thermo are left as NULL, then the numbers of the nodes
(or of the tips) are printed.
If node, tip, or edge is missing, then the text
or the symbols are printed on all nodes, tips, or edges.
The option cex can be used to change the size of all types of
labels.
A simple call of these functions with no arguments (e.g.,
nodelabels()) prints the numbers of all nodes (or tips).
In the case of tiplabels, it would be useful to play with the
options x.lim and label.offset (and possibly
show.tip.label) of plot.phylo in most cases (see the
examples).
Emmanuel Paradis, Ben Bolker, and Jim Lemon
plot.phylo, edges,
mixedFontLabel
tr <- read.tree(text = "((Homo,Pan),Gorilla);") plot(tr) nodelabels("7.3 Ma", 4, frame = "r", bg = "yellow", adj = 0) nodelabels("5.4 Ma", 5, frame = "c", bg = "tomato", font = 3) ## A trick by Liam Revell when there are many categories: plot(tr, x.lim = c(-1, 4)) nodelabels(node = 4, pie = matrix(rep(1, 100), 1), cex = 5) op <- par(fg = "transparent") nodelabels(node = 5, pie = matrix(rep(1, 100), 1), cex = 5) par(op) data(bird.orders) plot(bird.orders, use.edge.length = FALSE, font = 1) bs <- round(runif(22, 90, 100), 0) # some imaginary bootstrap values bs2 <- round(runif(22, 90, 100), 0) bs3 <- round(runif(22, 90, 100), 0) nodelabels(bs, adj = 1.2) nodelabels(bs2, adj = -0.2, bg = "yellow") ### something more classical plot(bird.orders, use.edge.length = FALSE, font = 1) nodelabels(bs, adj = -0.2, frame = "n", cex = 0.8) nodelabels(bs2, adj = c(1.2, 1), frame = "n", cex = 0.8) nodelabels(bs3, adj = c(1.2, -0.2), frame = "n", cex = 0.8) ### the same but we play with the font plot(bird.orders, use.edge.length = FALSE, font = 1) nodelabels(bs, adj = -0.2, frame = "n", cex = 0.8, font = 2) nodelabels(bs2, adj = c(1.2, 1), frame = "n", cex = 0.8, font = 3) nodelabels(bs3, adj = c(1.2, -0.2), frame = "n", cex = 0.8) plot(bird.orders, "c", use.edge.length = FALSE, font = 1) nodelabels(thermo = runif(22), cex = .8) plot(bird.orders, "u", FALSE, font = 1, lab4ut = "a") nodelabels(cex = .75, bg = "yellow") ### representing two characters at the tips (you could have as many ### as you want) plot(bird.orders, "c", FALSE, font = 1, label.offset = 3, x.lim = 31, no.margin = TRUE) tiplabels(pch = 21, bg = gray(1:23/23), cex = 2, adj = 1.4) tiplabels(pch = 19, col = c("yellow", "red", "blue"), adj = 2.5, cex = 2) ### This can be used to highlight tip labels: plot(bird.orders, font = 1) i <- c(1, 7, 18) tiplabels(bird.orders$tip.label[i], i, adj = 0) ### Some random data to compare piecharts and thermometres: tr <- rtree(15) x <- runif(14, 0, 0.33) y <- runif(14, 0, 0.33) z <- runif(14, 0, 0.33) x <- cbind(x, y, z, 1 - x - y - z) layout(matrix(1:2, 1, 2)) plot(tr, "c", FALSE, no.margin = TRUE) nodelabels(pie = x, cex = 1.3) text(4.5, 15, "Are you \"pie\"...", font = 4, cex = 1.5) plot(tr, "c", FALSE, no.margin = TRUE) nodelabels(thermo = x, col = rainbow(4), cex = 1.3) text(4.5, 15, "... or \"thermo\"?", font = 4, cex = 1.5) plot(tr, "c", FALSE, no.margin = TRUE) nodelabels(thermo = x, col = rainbow(4), cex = 1.3) plot(tr, "c", FALSE, no.margin = TRUE) nodelabels(thermo = x, col = rainbow(4), width = 3, horiz = TRUE) layout(1) plot(tr, main = "Showing Edge Lengths") edgelabels(round(tr$edge.length, 3), srt = 90) plot(tr, "p", FALSE) edgelabels("above", adj = c(0.5, -0.25), bg = "yellow") edgelabels("below", adj = c(0.5, 1.25), bg = "lightblue")tr <- read.tree(text = "((Homo,Pan),Gorilla);") plot(tr) nodelabels("7.3 Ma", 4, frame = "r", bg = "yellow", adj = 0) nodelabels("5.4 Ma", 5, frame = "c", bg = "tomato", font = 3) ## A trick by Liam Revell when there are many categories: plot(tr, x.lim = c(-1, 4)) nodelabels(node = 4, pie = matrix(rep(1, 100), 1), cex = 5) op <- par(fg = "transparent") nodelabels(node = 5, pie = matrix(rep(1, 100), 1), cex = 5) par(op) data(bird.orders) plot(bird.orders, use.edge.length = FALSE, font = 1) bs <- round(runif(22, 90, 100), 0) # some imaginary bootstrap values bs2 <- round(runif(22, 90, 100), 0) bs3 <- round(runif(22, 90, 100), 0) nodelabels(bs, adj = 1.2) nodelabels(bs2, adj = -0.2, bg = "yellow") ### something more classical plot(bird.orders, use.edge.length = FALSE, font = 1) nodelabels(bs, adj = -0.2, frame = "n", cex = 0.8) nodelabels(bs2, adj = c(1.2, 1), frame = "n", cex = 0.8) nodelabels(bs3, adj = c(1.2, -0.2), frame = "n", cex = 0.8) ### the same but we play with the font plot(bird.orders, use.edge.length = FALSE, font = 1) nodelabels(bs, adj = -0.2, frame = "n", cex = 0.8, font = 2) nodelabels(bs2, adj = c(1.2, 1), frame = "n", cex = 0.8, font = 3) nodelabels(bs3, adj = c(1.2, -0.2), frame = "n", cex = 0.8) plot(bird.orders, "c", use.edge.length = FALSE, font = 1) nodelabels(thermo = runif(22), cex = .8) plot(bird.orders, "u", FALSE, font = 1, lab4ut = "a") nodelabels(cex = .75, bg = "yellow") ### representing two characters at the tips (you could have as many ### as you want) plot(bird.orders, "c", FALSE, font = 1, label.offset = 3, x.lim = 31, no.margin = TRUE) tiplabels(pch = 21, bg = gray(1:23/23), cex = 2, adj = 1.4) tiplabels(pch = 19, col = c("yellow", "red", "blue"), adj = 2.5, cex = 2) ### This can be used to highlight tip labels: plot(bird.orders, font = 1) i <- c(1, 7, 18) tiplabels(bird.orders$tip.label[i], i, adj = 0) ### Some random data to compare piecharts and thermometres: tr <- rtree(15) x <- runif(14, 0, 0.33) y <- runif(14, 0, 0.33) z <- runif(14, 0, 0.33) x <- cbind(x, y, z, 1 - x - y - z) layout(matrix(1:2, 1, 2)) plot(tr, "c", FALSE, no.margin = TRUE) nodelabels(pie = x, cex = 1.3) text(4.5, 15, "Are you \"pie\"...", font = 4, cex = 1.5) plot(tr, "c", FALSE, no.margin = TRUE) nodelabels(thermo = x, col = rainbow(4), cex = 1.3) text(4.5, 15, "... or \"thermo\"?", font = 4, cex = 1.5) plot(tr, "c", FALSE, no.margin = TRUE) nodelabels(thermo = x, col = rainbow(4), cex = 1.3) plot(tr, "c", FALSE, no.margin = TRUE) nodelabels(thermo = x, col = rainbow(4), width = 3, horiz = TRUE) layout(1) plot(tr, main = "Showing Edge Lengths") edgelabels(round(tr$edge.length, 3), srt = 90) plot(tr, "p", FALSE) edgelabels("above", adj = c(0.5, -0.25), bg = "yellow") edgelabels("below", adj = c(0.5, 1.25), bg = "lightblue")
This function finds paths of nodes in a tree. The nodes can be internal and/or terminal (i.e., tips).
nodepath(phy, from = NULL, to = NULL)nodepath(phy, from = NULL, to = NULL)
phy |
an object of class |
from, to
|
integers giving node or tip numbers. |
By default, this function returns all the paths from the root to each
tip of the tree. If both arguments from and to are
specified, the shortest path of nodes linking them is returned.
a list of vectors of integers (by default), or a single vector of integers.
Emmanuel Paradis
tr <- rtree(2) nodepath(tr) nodepath(tr, 1, 2)tr <- rtree(2) nodepath(tr) nodepath(tr, 1, 2)
Function parafit tests the hypothesis of coevolution between a clade of hosts and a clade of parasites. The null hypothesis (H0) of the global test is that the evolution of the two groups, as revealed by the two phylogenetic trees and the set of host-parasite association links, has been independent. Tests of individual host-parasite links are also available as an option.
The method, which is described in detail in Legendre et al. (2002), requires some estimates of the phylogenetic trees or phylogenetic distances, and also a description of the host-parasite associations (H-P links) observed in nature.
parafit(host.D, para.D, HP, nperm = 999, test.links = FALSE, seed = NULL, correction = "none", silent = FALSE)parafit(host.D, para.D, HP, nperm = 999, test.links = FALSE, seed = NULL, correction = "none", silent = FALSE)
host.D |
A matrix of phylogenetic or patristic distances among the hosts (object class: |
para.D |
A matrix of phylogenetic or patristic distances among the parasites (object class: |
HP |
A rectangular matrix with hosts as rows and parasites as columns. The matrix contains 1's when a host-parasite link has been observed in nature between the host in the row and the parasite in the column, and 0's otherwise. |
nperm |
Number of permutations for the tests. If |
test.links |
|
seed |
|
correction |
Correction methods for negative eigenvalues (details below): |
silent |
Informative messages and the time to compute the tests will not be written to the R console if silent=TRUE. Useful when the function is called by a numerical simulation function. |
Two types of test are produced by the program: a global test of coevolution and, optionally, a test on the individual host-parasite (H-P) link.
The function computes principal coordinates for the host and the parasite distance matrices. The principal coordinates (all of them) act as a complete representation of either the phylogenetic distance matrix or the phylogenetic tree.
Phylogenetic distance matrices are normally Euclidean. Patristic distance matrices are additive, thus they are metric and Euclidean. Euclidean matrices are fully represented by real-valued principal coordinate axes. For non-Euclidean matrices, negative eigenvalues are produced; complex principal coordinate axes are associated with the negative eigenvalues. So, the program rejects matrices that are not Euclidean and stops.
Negative eigenvalues can be corrected for by one of two methods: the Lingoes or the Caillez correction. It is up to the user to decide which correction method should be applied. This is done by selecting the option correction="lingoes" or correction="cailliez". Details on these correction methods are given in the help file of the pcoa function.
The principle of the global test is the following (H0: independent evolution of the hosts and parasites): (1) Compute matrix D = C t(A) B. Note: D is a fourth-corner matrix (sensu Legendre et al. 1997), where A is the H-P link matrix, B is the matrix of principal coordinates computed from the host.D matrix, and C is the matrix of principal coordinates computed from the para.D matrix. (2) Compute the statistic ParaFitGlobal, the sum of squares of all values in matrix D. (3) Permute at random, separately, each row of matrix A, obtaining matrix A.perm. Compute D.perm = C
The test of each individual H-P link is carried out as follows (H0: this particular link is random): (1) Remove one link (k) from matrix A. (2) Compute matrix D = C t(A) B. (3a) Compute trace(k), the sum of squares of all values in matrix D. (3b) Compute the statistic ParaFitLink1 = (trace - trace(k)) where trace is the ParaFitGlobal statistic. (3c) Compute the statistic ParaFitLink2 = (trace - trace(k)) / (tracemax - trace) where tracemax is the maximum value that can be taken by trace. (4) Permute at random, separately, each row of matrix A, obtaining A.perm. Use the same sequences of permutations as were used in the test of ParaFitGlobal. Using the values of trace and trace.perm saved during the global test, compute the permuted values of the two statistics, ParaFit1.perm and ParaFit2.perm. (5) Repeat step 4 a large number of times. (6) Add the reference value of ParaFit1 to the distribution of ParaFit1.perm values; add the reference value of ParaFit2 to the distribution of ParaFit2.perm values. Calculate the permutational probabilities associated to ParaFit1 and ParaFit2.
The print.parafit function prints out the results of the global test and, optionally, the results of the tests of the individual host-parasite links.
ParaFitGlobal |
The statistic of the global H-P test. |
p.global |
The permutational p-value associated with the ParaFitGlobal statistic. |
link.table |
The results of the tests of individual H-P links, including the ParaFitLink1 and ParaFitLink2 statistics and the p-values obtained from their respective permutational tests. |
para.per.host |
Number of parasites per host. |
host.per.para |
Number of hosts per parasite. |
nperm |
Number of permutations for the tests. |
Pierre Legendre, Universite de Montreal
Hafner, M. S, P. D. Sudman, F. X. Villablanca, T. A. Spradling, J. W. Demastes and S. A. Nadler. 1994. Disparate rates of molecular evolution in cospeciating hosts and parasites. Science, 265, 1087–1090.
Legendre, P., Y. Desdevises and E. Bazin. 2002. A statistical test for host-parasite coevolution. Systematic Biology, 51(2), 217–234.
## Gopher and lice data from Hafner et al. (1994) data(gopher.D) data(lice.D) data(HP.links) res <- parafit(gopher.D, lice.D, HP.links, nperm=99, test.links=TRUE) # res # or else: print(res)## Gopher and lice data from Hafner et al. (1994) data(gopher.D) data(lice.D) data(HP.links) res <- parafit(gopher.D, lice.D, HP.links, nperm=99, test.links=TRUE) # res # or else: print(res)
Function pcoa computes principal coordinate decomposition
(also called classical scaling) of a distance matrix D (Gower 1966). It
implements two correction methods for negative eigenvalues.
pcoa(D, correction="none", rn=NULL) ## S3 method for class 'pcoa' biplot(x, Y=NULL, plot.axes = c(1,2), dir.axis1=1, dir.axis2=1, rn=NULL, main=NULL, ...)pcoa(D, correction="none", rn=NULL) ## S3 method for class 'pcoa' biplot(x, Y=NULL, plot.axes = c(1,2), dir.axis1=1, dir.axis2=1, rn=NULL, main=NULL, ...)
D |
A distance matrix of class |
correction |
Correction methods for negative eigenvalues (details
below): |
rn |
An optional vector of row names, of length n, for the n objects. |
x |
Output object from |
Y |
Any rectangular data table containing explanatory variables to be projected onto the ordination plot. That table may contain, for example, the community composition data used to compute D, or any transformation of these data; see examples. |
plot.axes |
The two PCoA axes to plot. |
dir.axis1 |
= -1 to revert axis 1 for the projection of points and variables. Default value: +1. |
dir.axis2 |
= -1 to revert axis 2 for the projection of points and variables. Default value: +1. |
main |
An optional title. |
... |
Other graphical arguments passed to function. |
This function implements two methods for correcting for negative values in principal coordinate analysis (PCoA). Negative eigenvalues can be produced in PCoA when decomposing distance matrices produced by coefficients that are not Euclidean (Gower and Legendre 1986,Legendre and Legendre 1998).
In pcoa, when negative eigenvalues are present in the
decomposition results, the distance matrix D can be modified using
either the Lingoes or the Cailliez procedure to produce results
without negative eigenvalues.
In the Lingoes (1971) procedure, a constant c1, equal to twice absolute value of the largest negative value of the original principal coordinate analysis, is added to each original squared distance in the distance matrix, except the diagonal values. A newe principal coordinate analysis, performed on the modified distances, has at most (n-2) positive eigenvalues, at least 2 null eigenvalues, and no negative eigenvalue.
In the Cailliez (1983) procedure, a constant c2 is added to the original distances in the distance matrix, except the diagonal values. The calculation of c2 is described in Legendre and Legendre (1998). A new principal coordinate analysis, performed on the modified distances, has at most (n-2) positive eigenvalues, at least 2 null eigenvalues, and no negative eigenvalue.
In all cases, only the eigenvectors corresponding to positive eigenvalues are shown in the output list. The eigenvectors are scaled to the square root of the corresponding eigenvalues. Gower (1966) has shown that eigenvectors scaled in that way preserve the original distance (in the D matrix) among the objects. These eigenvectors can be used to plot ordination graphs of the objects.
We recommend not to use PCoA to produce ordinations from the chord,
chi-square, abundance profile, or Hellinger distances. It is easier to
first transform the community composition data using the following
transformations, available in the decostand function of the
vegan package, and then carry out a principal component
analysis (PCA) on the transformed data:
Chord transformation: decostand(spiders,"normalize")
Transformation to relative abundance profiles: decostand(spiders,"total")
Hellinger transformation: decostand(spiders,"hellinger")
Chi-square transformation: decostand(spiders,"chi.square")
The ordination results will be identical and the calculations shorter. This two-step ordination method, called transformation-based PCA (tb-PCA), was described by Legendre and Gallagher (2001).
The biplot.pcoa function produces plots for any pair of
principal coordinates. The original variables can be projected onto
the ordination plot.
correction |
The values of parameter |
note |
A note describing the type of correction done, if any. |
values |
The eigenvalues and related information: |
Eigenvalues |
All eigenvalues (positive, null, negative). |
Relative_eig |
Relative eigenvalues. |
Corr_eig |
Corrected eigenvalues (Lingoes correction); Legendre and Legendre (1998, p. 438, eq. 9.27). |
Rel_corr_eig |
Relative eigenvalues after Lingoes or Cailliez correction. |
Broken_stick |
Expected fractions of variance under the broken stick model. |
Cumul_eig |
Cumulative relative eigenvalues. |
Cum_corr_eig |
Cumulative corrected relative eigenvalues. |
Cumul_br_stick |
Cumulative broken stick fractions. |
vectors |
The principal coordinates with positive eigenvalues. |
trace |
The trace of the distance matrix. This is also the sum of all eigenvalues, positive and negative. |
vectors.cor |
The principal coordinates with positive
eigenvalues from the distance matrix corrected using the method
specified by parameter |
trace.cor |
The trace of the corrected distance matrix. This is also the sum of its eigenvalues. |
Pierre Legendre, Universite de Montreal
Cailliez, F. (1983) The analytical solution of the additive constant problem. Psychometrika, 48, 305–308.
Gower, J. C. (1966) Some distance properties of latent root and vector methods used in multivariate analysis. Biometrika, 53, 325–338.
Gower, J. C. and Legendre, P. (1986) Metric and Euclidean properties of dissimilarity coefficients. Journal of Classification, 3, 5–48.
Legendre, P. and Gallagher, E. D. (2001) Ecologically meaningful transformations for ordination of species data. Oecologia, 129, 271–280.
Legendre, P. and Legendre, L. (1998) Numerical Ecology, 2nd English edition. Amsterdam: Elsevier Science BV.
Lingoes, J. C. (1971) Some boundary conditions for a monotone analysis of symmetric matrices. Psychometrika, 36, 195–203.
## Oribatid mite data from Borcard and Legendre (1994) ## Not run: if (require(vegan)) { data(mite) # Community composition data, 70 peat cores, 35 species ## Select rows 1:30. Species 35 is absent from these rows. Transform to log mite.log <- log(mite[1:30, -35] + 1) # Equivalent: log1p(mite[1:30, -35]) ## Principal coordinate analysis and simple ordination plot mite.D <- vegdist(mite.log, "bray") res <- pcoa(mite.D) res$values biplot(res) ## Project unstandardized and standardized species on the PCoA ordination plot mite.log.st = apply(mite.log, 2, scale, center=TRUE, scale=TRUE) par(mfrow=c(1,2)) biplot(res, mite.log) biplot(res, mite.log.st) # Reverse the ordination axes in the plot par(mfrow=c(1,2)) biplot(res, mite.log, dir.axis1=-1, dir.axis2=-1) biplot(res, mite.log.st, dir.axis1=-1, dir.axis2=-1) } ## End(Not run)## Oribatid mite data from Borcard and Legendre (1994) ## Not run: if (require(vegan)) { data(mite) # Community composition data, 70 peat cores, 35 species ## Select rows 1:30. Species 35 is absent from these rows. Transform to log mite.log <- log(mite[1:30, -35] + 1) # Equivalent: log1p(mite[1:30, -35]) ## Principal coordinate analysis and simple ordination plot mite.D <- vegdist(mite.log, "bray") res <- pcoa(mite.D) res$values biplot(res) ## Project unstandardized and standardized species on the PCoA ordination plot mite.log.st = apply(mite.log, 2, scale, center=TRUE, scale=TRUE) par(mfrow=c(1,2)) biplot(res, mite.log) biplot(res, mite.log.st) # Reverse the ordination axes in the plot par(mfrow=c(1,2)) biplot(res, mite.log, dir.axis1=-1, dir.axis2=-1) biplot(res, mite.log.st, dir.axis1=-1, dir.axis2=-1) } ## End(Not run)
phydataplot plots data on a tree in a way that adapts to the
type of tree. ring does the same for circular trees.
Both functions match the data with the labels of the tree.
phydataplot(x, phy, style = "bars", offset = 1, scaling = 1, continuous = FALSE, width = NULL, legend = "below", funcol = rainbow, ...) ring(x, phy, style = "ring", offset = 1, ...)phydataplot(x, phy, style = "bars", offset = 1, scaling = 1, continuous = FALSE, width = NULL, legend = "below", funcol = rainbow, ...) ring(x, phy, style = "ring", offset = 1, ...)
x |
a vector, a factor, a matrix, or a data frame. |
phy |
the tree (which must be already plotted). |
style |
a character string specifying the type of graphics; can be abbreviated (see details). |
offset |
the space between the tips of the tree and the plot. |
scaling |
the scaling factor to apply to the data. |
continuous |
(used if style="mosaic") a logical specifying
whether to treat the values in |
width |
(used if style = "mosaic") the width of the cells; by default, all the available space is used. |
legend |
(used if style = "mosaic") the place where to draw the
legend; one of |
funcol |
(used if style = "mosaic") the function used to generate the colours (see details and examples). |
... |
further arguments passed to the graphical functions. |
The possible values for style are “bars”, “segments”,
“image”, “arrows”, “boxplot”, “dotchart”, or “mosaic” for
phydataplot, and “ring”, “segments”, or “arrows” for
ring.
style = "image" works only with square matrices (e.g.,
similarities). If you want to plot a DNA alignment in the same way
than image.DNAbin, try style = "mosaic".
style = "mosaic" can plot any kind of matrices, possibly after
discretizing its values (using continuous). The default colour
palette is taken from the function rainbow.
If you want to use specified colours, a function simply returning the
vector of colours must be used, possibly with names if you want to
assign a specific colour to each value (see examples).
For the moment, only rightwards trees are supported (does not apply to circular trees).
Emmanuel Paradis
plot.phylo, nodelabels,
fancyarrows
## demonstrates matching with names: tr <- rcoal(n <- 10) x <- 1:n names(x) <- tr$tip.label plot(tr, x.lim = 11) phydataplot(x, tr) ## shuffle x but matching names with tip labels reorders them: phydataplot(sample(x), tr, "s", lwd = 3, lty = 3) ## adapts to the tree: plot(tr, "f", x.l = c(-11, 11), y.l = c(-11, 11)) phydataplot(x, tr, "s") ## leave more space with x.lim to show a barplot and a dotchart: plot(tr, x.lim = 22) phydataplot(x, tr, col = "yellow") phydataplot(x, tr, "d", offset = 13) ts <- rcoal(N <- 100) X <- rTraitCont(ts) # names are set dd <- dist(X) op <- par(mar = rep(0, 4)) plot(ts, x.lim = 10, cex = 0.4, font = 1) phydataplot(as.matrix(dd), ts, "i", offset = 0.2) par(xpd = TRUE, mar = op$mar) co <- c("blue", "red"); l <- c(-2, 2) X <- X + abs(min(X)) # move scale so X >= 0 plot(ts, "f", show.tip.label = FALSE, x.lim = l, y.lim = l, open.angle = 30) phydataplot(X, ts, "s", col = co, offset = 0.05) ring(X, ts, "ring", col = co, offset = max(X) + 0.1) # the same info as a ring ## as many rings as you want... co <- c("blue", "yellow") plot(ts, "r", show.tip.label = FALSE, x.l = c(-1, 1), y.l = c(-1, 1)) for (o in seq(0, 0.4, 0.2)) { co <- rev(co) ring(0.2, ts, "r", col = rep(co, each = 5), offset = o) } lim <- c(-5, 5) co <- rgb(0, 0.4, 1, alpha = 0.1) y <- seq(0.01, 1, 0.01) plot(ts, "f", x.lim = lim, y.lim = lim, show.tip.label = FALSE) ring(y, ts, offset = 0, col = co, lwd = 0.1) for (i in 1:3) { y <- y + 1 ring(y, ts, offset = 0, col = co, lwd = 0.1) } ## rings can be in the background plot(ts, "r", plot = FALSE) ring(1, ts, "r", col = rainbow(100), offset = -1) par(new = TRUE) plot(ts, "r", font = 1, edge.color = "white") ## might be more useful: co <- c("lightblue", "yellow") plot(ts, "r", plot = FALSE) ring(0.1, ts, "r", col = sample(co, size = N, rep = TRUE), offset = -.1) par(new = TRUE) plot(ts, "r", font = 1) ## if x is matrix: tx <- rcoal(m <- 20) X <- runif(m, 0, 0.5); Y <- runif(m, 0, 0.5) X <- cbind(X, Y, 1 - X - Y) rownames(X) <- tx$tip.label plot(tx, x.lim = 6) co <- rgb(diag(3)) phydataplot(X, tx, col = co) ## a variation: plot(tx, show.tip.label = FALSE, x.lim = 5) phydataplot(X, tx, col = co, offset = 0.05, border = NA) plot(tx, "f", show.tip.label = FALSE, open.angle = 180) ring(X, tx, col = co, offset = 0.05) Z <- matrix(rnorm(m * 5), m) rownames(Z) <- rownames(X) plot(tx, x.lim = 5) phydataplot(Z, tx, "bo", scaling = .5, offset = 0.5, boxfill = c("gold", "skyblue")) ## plot an alignment with a NJ tree: data(woodmouse) trw <- nj(dist.dna(woodmouse)) plot(trw, x.lim = 0.1, align.tip = TRUE, font = 1) phydataplot(woodmouse[, 1:50], trw, "m", 0.02, border = NA) ## use type = "mosaic" on a 30x5 matrix: tr <- rtree(n <- 30) p <- 5 x <- matrix(sample(3, size = n*p, replace = TRUE), n, p) dimnames(x) <- list(paste0("t", 1:n), LETTERS[1:p]) plot(tr, x.lim = 35, align.tip = TRUE, adj = 1) phydataplot(x, tr, "m", 2) ## change the aspect: plot(tr, x.lim = 35, align.tip = TRUE, adj = 1) phydataplot(x, tr, "m", 2, width = 2, border = "white", lwd = 3, legend = "side") ## user-defined colour: f <- function(n) c("yellow", "blue", "red") phydataplot(x, tr, "m", 18, width = 2, border = "white", lwd = 3, legend = "side", funcol = f) ## alternative colour function...: ## fb <- function(n) c("3" = "red", "2" = "blue", "1" = "yellow") ## ... but since the values are sorted alphabetically, ## both f and fb will produce the same plot. ## use continuous = TRUE with two different scales: x[] <- 1:(n*p) plot(tr, x.lim = 35, align.tip = TRUE, adj = 1) phydataplot(x, tr, "m", 2, width = 1.5, continuous = TRUE, legend = "side", funcol = colorRampPalette(c("white", "darkgreen"))) phydataplot(x, tr, "m", 18, width = 1.5, continuous = 5, legend = "side", funcol = topo.colors)## demonstrates matching with names: tr <- rcoal(n <- 10) x <- 1:n names(x) <- tr$tip.label plot(tr, x.lim = 11) phydataplot(x, tr) ## shuffle x but matching names with tip labels reorders them: phydataplot(sample(x), tr, "s", lwd = 3, lty = 3) ## adapts to the tree: plot(tr, "f", x.l = c(-11, 11), y.l = c(-11, 11)) phydataplot(x, tr, "s") ## leave more space with x.lim to show a barplot and a dotchart: plot(tr, x.lim = 22) phydataplot(x, tr, col = "yellow") phydataplot(x, tr, "d", offset = 13) ts <- rcoal(N <- 100) X <- rTraitCont(ts) # names are set dd <- dist(X) op <- par(mar = rep(0, 4)) plot(ts, x.lim = 10, cex = 0.4, font = 1) phydataplot(as.matrix(dd), ts, "i", offset = 0.2) par(xpd = TRUE, mar = op$mar) co <- c("blue", "red"); l <- c(-2, 2) X <- X + abs(min(X)) # move scale so X >= 0 plot(ts, "f", show.tip.label = FALSE, x.lim = l, y.lim = l, open.angle = 30) phydataplot(X, ts, "s", col = co, offset = 0.05) ring(X, ts, "ring", col = co, offset = max(X) + 0.1) # the same info as a ring ## as many rings as you want... co <- c("blue", "yellow") plot(ts, "r", show.tip.label = FALSE, x.l = c(-1, 1), y.l = c(-1, 1)) for (o in seq(0, 0.4, 0.2)) { co <- rev(co) ring(0.2, ts, "r", col = rep(co, each = 5), offset = o) } lim <- c(-5, 5) co <- rgb(0, 0.4, 1, alpha = 0.1) y <- seq(0.01, 1, 0.01) plot(ts, "f", x.lim = lim, y.lim = lim, show.tip.label = FALSE) ring(y, ts, offset = 0, col = co, lwd = 0.1) for (i in 1:3) { y <- y + 1 ring(y, ts, offset = 0, col = co, lwd = 0.1) } ## rings can be in the background plot(ts, "r", plot = FALSE) ring(1, ts, "r", col = rainbow(100), offset = -1) par(new = TRUE) plot(ts, "r", font = 1, edge.color = "white") ## might be more useful: co <- c("lightblue", "yellow") plot(ts, "r", plot = FALSE) ring(0.1, ts, "r", col = sample(co, size = N, rep = TRUE), offset = -.1) par(new = TRUE) plot(ts, "r", font = 1) ## if x is matrix: tx <- rcoal(m <- 20) X <- runif(m, 0, 0.5); Y <- runif(m, 0, 0.5) X <- cbind(X, Y, 1 - X - Y) rownames(X) <- tx$tip.label plot(tx, x.lim = 6) co <- rgb(diag(3)) phydataplot(X, tx, col = co) ## a variation: plot(tx, show.tip.label = FALSE, x.lim = 5) phydataplot(X, tx, col = co, offset = 0.05, border = NA) plot(tx, "f", show.tip.label = FALSE, open.angle = 180) ring(X, tx, col = co, offset = 0.05) Z <- matrix(rnorm(m * 5), m) rownames(Z) <- rownames(X) plot(tx, x.lim = 5) phydataplot(Z, tx, "bo", scaling = .5, offset = 0.5, boxfill = c("gold", "skyblue")) ## plot an alignment with a NJ tree: data(woodmouse) trw <- nj(dist.dna(woodmouse)) plot(trw, x.lim = 0.1, align.tip = TRUE, font = 1) phydataplot(woodmouse[, 1:50], trw, "m", 0.02, border = NA) ## use type = "mosaic" on a 30x5 matrix: tr <- rtree(n <- 30) p <- 5 x <- matrix(sample(3, size = n*p, replace = TRUE), n, p) dimnames(x) <- list(paste0("t", 1:n), LETTERS[1:p]) plot(tr, x.lim = 35, align.tip = TRUE, adj = 1) phydataplot(x, tr, "m", 2) ## change the aspect: plot(tr, x.lim = 35, align.tip = TRUE, adj = 1) phydataplot(x, tr, "m", 2, width = 2, border = "white", lwd = 3, legend = "side") ## user-defined colour: f <- function(n) c("yellow", "blue", "red") phydataplot(x, tr, "m", 18, width = 2, border = "white", lwd = 3, legend = "side", funcol = f) ## alternative colour function...: ## fb <- function(n) c("3" = "red", "2" = "blue", "1" = "yellow") ## ... but since the values are sorted alphabetically, ## both f and fb will produce the same plot. ## use continuous = TRUE with two different scales: x[] <- 1:(n*p) plot(tr, x.lim = 35, align.tip = TRUE, adj = 1) phydataplot(x, tr, "m", 2, width = 1.5, continuous = TRUE, legend = "side", funcol = colorRampPalette(c("white", "darkgreen"))) phydataplot(x, tr, "m", 18, width = 1.5, continuous = 5, legend = "side", funcol = topo.colors)
This function calls PhyML and fits successively 28 models of DNA evolution. The results are saved on disk, as PhyML usually does, and returned in R as a vector with the log-likelihood value of each model.
phymltest(seqfile, format = "interleaved", itree = NULL, exclude = NULL, execname = NULL, append = TRUE) ## S3 method for class 'phymltest' print(x, ...) ## S3 method for class 'phymltest' summary(object, ...) ## S3 method for class 'phymltest' plot(x, main = NULL, col = "blue", ...)phymltest(seqfile, format = "interleaved", itree = NULL, exclude = NULL, execname = NULL, append = TRUE) ## S3 method for class 'phymltest' print(x, ...) ## S3 method for class 'phymltest' summary(object, ...) ## S3 method for class 'phymltest' plot(x, main = NULL, col = "blue", ...)
seqfile |
a character string giving the name of the file that contains the DNA sequences to be analysed by PhyML. |
format |
a character string specifying the format of the DNA
sequences: either |
itree |
a character string giving the name of a file with a tree
in Newick format to be used as an initial tree by PhyML. If
|
exclude |
a vector of mode character giving the models to be excluded from the analysis. These must be among those below, and follow the same syntax. |
execname |
a character string specifying the name of the PhyML
executable. This argument can be left as |
append |
a logical indicating whether to erase previous PhyML output files if present; the default is to not erase. |
x |
an object of class |
object |
an object of class |
main |
a title for the plot; if left |
col |
a colour used for the segments showing the AIC values (blue by default). |
... |
further arguments passed to or from other methods. |
The present function requires version 3.0.1 of PhyML; it won't work with older versions.
The user must take care to set correctly the three different paths involved here: the path to PhyML's binary, the path to the sequence file, and the path to R's working directory. The function should work if all three paths are different. Obviously, there should be no problem if they are all the same.
The following syntax is used for the models:
"X[Y][Z]00[+I][+G]"
where "X" is the first letter of the author of the model, "Y" and "Z" are possibly other co-authors of the model, "00" is the year of the publication of the model, and "+I" and "+G" indicates whether the presence of invariant sites and/or a gamma distribution of substitution rates have been specified. Thus, Kimura's model is denoted "K80" and not "K2P". The exception to this rule is the general time-reversible model which is simply denoted "GTR" model.
The seven substitution models used are: "JC69", "K80", "F81", "F84",
"HKY85", "TN93", and "GTR". These models are then altered by adding
the "+I" and/or "+G", resulting thus in four variants for each of them
(e.g., "JC69", "JC69+I", "JC69+G", "JC69+I+G"). Some of these models
are described in the help page of dist.dna.
When a gamma distribution of substitution rates is specified, four categories are used (which is PhyML's default behaviour), and the “alpha” parameter is estimated from the data.
For the models with a different substition rate for transitions and transversions, these rates are left free and estimated from the data (and not constrained with a ratio of 4 as in PhyML's default).
The option path2exec has been removed in the present version:
the path to PhyML's executable can be specified with the option
execname.
phymltest returns an object of class "phymltest": a
numeric vector with the models as names.
The print method prints an object of class "phymltest"
as matrix with the name of the models, the number of free parameters,
the log-likelihood value, and the value of the Akaike information
criterion (AIC = -2 * loglik + 2 * number of free parameters)
The summary method prints all the possible likelihood ratio
tests for an object of class "phymltest".
The plot method plots the values of AIC of an object of class
"phymltest" on a vertical scale.
It is important to note that the models fitted by this function is only a small fraction of the models possible with PhyML. For instance, it is possible to vary the number of categories in the (discretized) gamma distribution of substitution rates, and many parameters can be fixed by the user. The results from the present function should rather be taken as indicative of a best model.
Emmanuel Paradis
Posada, D. and Crandall, K. A. (2001) Selecting the best-fit model of nucleotide substitution. Systematic Biology, 50, 580–601.
Guindon, S. and Gascuel, O. (2003) A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology, 52, 696–704. http://www.atgc-montpellier.fr/phyml/
read.tree, write.tree,
dist.dna
### A `fake' example with random likelihood values: it does not ### make sense, but does not need PhyML and gives you a flavour ### of what the output looks like: x <- runif(28, -100, -50) names(x) <- ape:::.phymltest.model class(x) <- "phymltest" x summary(x) plot(x) plot(x, main = "", col = "red") ### This example needs PhyML, copy/paste or type the ### following commands if you want to try them, eventually ### changing setwd() and the options of phymltest() ## Not run: setwd("D:/phyml_v2.4/exe") # under Windows data(woodmouse) write.dna(woodmouse, "woodmouse.txt") X <- phymltest("woodmouse.txt") X summary(X) plot(X) ## End(Not run)### A `fake' example with random likelihood values: it does not ### make sense, but does not need PhyML and gives you a flavour ### of what the output looks like: x <- runif(28, -100, -50) names(x) <- ape:::.phymltest.model class(x) <- "phymltest" x summary(x) plot(x) plot(x, main = "", col = "red") ### This example needs PhyML, copy/paste or type the ### following commands if you want to try them, eventually ### changing setwd() and the options of phymltest() ## Not run: setwd("D:/phyml_v2.4/exe") # under Windows data(woodmouse) write.dna(woodmouse, "woodmouse.txt") X <- phymltest("woodmouse.txt") X summary(X) plot(X) ## End(Not run)
Compute the phylogenetically independent contrasts using the method described by Felsenstein (1985).
pic(x, phy, scaled = TRUE, var.contrasts = FALSE, rescaled.tree = FALSE)pic(x, phy, scaled = TRUE, var.contrasts = FALSE, rescaled.tree = FALSE)
x |
a numeric vector. |
phy |
an object of class |
scaled |
logical, indicates whether the contrasts should be
scaled with their expected variances (default to |
var.contrasts |
logical, indicates whether the expected
variances of the contrasts should be returned (default to
|
rescaled.tree |
logical, if |
If x has names, its values are matched to the tip labels of
phy, otherwise its values are taken to be in the same order
than the tip labels of phy.
The user must be careful here since the function requires that both
series of names perfectly match. If both series of names do not match,
the values in the x are taken to be in the same order than the
tip labels of phy, and a warning message is issued.
either a vector of phylogenetically independent contrasts (if
var.contrasts = FALSE), or a two-column matrix with the
phylogenetically independent contrasts in the first column and their
expected variance in the second column (if var.contrasts =
TRUE). If the tree has node labels, these are used as labels of the
returned object.
If rescaled.tree = TRUE, a list is returned with two elements
named “contr” with the above results and “rescaled.tree” with the
tree and its rescaled branch lengths (see Felsenstein 1985).
Emmanuel Paradis
Felsenstein, J. (1985) Phylogenies and the comparative method. American Naturalist, 125, 1–15.
read.tree, compar.gee,
compar.lynch, pic.ortho,
varCompPhylip
### The example in Phylip 3.5c (originally from Lynch 1991) x <- "((((Homo:0.21,Pongo:0.21):0.28,Macaca:0.49):0.13,Ateles:0.62):0.38,Galago:1.00);" tree.primates <- read.tree(text = x) X <- c(4.09434, 3.61092, 2.37024, 2.02815, -1.46968) Y <- c(4.74493, 3.33220, 3.36730, 2.89037, 2.30259) names(X) <- names(Y) <- c("Homo", "Pongo", "Macaca", "Ateles", "Galago") pic.X <- pic(X, tree.primates) pic.Y <- pic(Y, tree.primates) cor.test(pic.X, pic.Y) lm(pic.Y ~ pic.X - 1) # both regressions lm(pic.X ~ pic.Y - 1) # through the origin### The example in Phylip 3.5c (originally from Lynch 1991) x <- "((((Homo:0.21,Pongo:0.21):0.28,Macaca:0.49):0.13,Ateles:0.62):0.38,Galago:1.00);" tree.primates <- read.tree(text = x) X <- c(4.09434, 3.61092, 2.37024, 2.02815, -1.46968) Y <- c(4.74493, 3.33220, 3.36730, 2.89037, 2.30259) names(X) <- names(Y) <- c("Homo", "Pongo", "Macaca", "Ateles", "Galago") pic.X <- pic(X, tree.primates) pic.Y <- pic(Y, tree.primates) cor.test(pic.X, pic.Y) lm(pic.Y ~ pic.X - 1) # both regressions lm(pic.X ~ pic.Y - 1) # through the origin
This function computes the orthonormal contrasts using the method described by Felsenstein (2008). Only a single trait can be analyzed; there can be several observations per species.
pic.ortho(x, phy, var.contrasts = FALSE, intra = FALSE)pic.ortho(x, phy, var.contrasts = FALSE, intra = FALSE)
x |
a numeric vector or a list of numeric vectors. |
phy |
an object of class |
var.contrasts |
logical, indicates whether the expected
variances of the contrasts should be returned (default to
|
intra |
logical, whether to return the intraspecific contrasts. |
The data x can be in two forms: a vector if there is a single
observation for each species, or a list whose elements are vectors
containing the individual observations for each species. These vectors
may be of different lengths.
If x has names, its values are matched to the tip labels of
phy, otherwise its values are taken to be in the same order
than the tip labels of phy.
either a vector of contrasts, or a two-column matrix with the
contrasts in the first column and their expected variances in the
second column (if var.contrasts = TRUE). If the tree has node
labels, these are used as labels of the returned object.
If intra = TRUE, the attribute "intra", a list of
vectors with the intraspecific contrasts or NULL for the
species with a one observation, is attached to the returned object.
Emmanuel Paradis
Felsenstein, J. (2008) Comparative methods with sampling error and within-species variation: Contrasts revisited and revised. American Naturalist, 171, 713–725.
tr <- rcoal(30) ### a single observation per species: x <- rTraitCont(tr) pic.ortho(x, tr) pic.ortho(x, tr, TRUE) ### different number of observations per species: x <- lapply(sample(1:5, 30, TRUE), rnorm) pic.ortho(x, tr, intra = TRUE)tr <- rcoal(30) ### a single observation per species: x <- rTraitCont(tr) pic.ortho(x, tr) pic.ortho(x, tr, TRUE) ### different number of observations per species: x <- lapply(sample(1:5, 30, TRUE), rnorm) pic.ortho(x, tr, intra = TRUE)
These functions plot correlagrams previously computed with
correlogram.formula.
## S3 method for class 'correlogram' plot(x, legend = TRUE, test.level = 0.05, col = c("grey", "red"), type = "b", xlab = "", ylab = "Moran's I", pch = 21, cex = 2, ...) ## S3 method for class 'correlogramList' plot(x, lattice = TRUE, legend = TRUE, test.level = 0.05, col = c("grey", "red"), xlab = "", ylab = "Moran's I", type = "b", pch = 21, cex = 2, ...)## S3 method for class 'correlogram' plot(x, legend = TRUE, test.level = 0.05, col = c("grey", "red"), type = "b", xlab = "", ylab = "Moran's I", pch = 21, cex = 2, ...) ## S3 method for class 'correlogramList' plot(x, lattice = TRUE, legend = TRUE, test.level = 0.05, col = c("grey", "red"), xlab = "", ylab = "Moran's I", type = "b", pch = 21, cex = 2, ...)
x |
an object of class |
legend |
should a legend be added on the plot? |
test.level |
the level used to discriminate the plotting symbols with colours considering the P-values. |
col |
two colours for the plotting symbols: the first one is used
if the P-value is greater than or equal to |
type |
the type of plot to produce (see
|
xlab |
an optional character string for the label on the x-axis (none by default). |
ylab |
the default label on the y-axis. |
pch |
the type of plotting symbol. |
cex |
the default size for the plotting symbols. |
lattice |
when plotting several correlograms, should they be plotted in trellis-style with lattice (the default), or together on the same plot? |
... |
other parameters passed to the |
When plotting several correlograms with lattice, some options have no
effect: legend, type, and pch (pch=19 is
always used in this situation).
When using pch between 1 and 20 (i.e., non-filled symbols, the
colours specified in col are also used for the lines joining
the points. To keep black lines, it is better to leave pch
between 21 and 25.
Emmanuel Paradis
These functions plot phylogenetic trees.
## S3 method for class 'phylo' plot(x, type = "phylogram", use.edge.length = TRUE, node.pos = NULL, show.tip.label = TRUE, show.node.label = FALSE, edge.color = NULL, edge.width = NULL, edge.lty = NULL, node.color = NULL, node.width = NULL, node.lty = NULL, font = 3, cex = par("cex"), adj = NULL, srt = 0, no.margin = FALSE, root.edge = FALSE, label.offset = 0, underscore = FALSE, x.lim = NULL, y.lim = NULL, direction = "rightwards", lab4ut = NULL, tip.color = par("col"), plot = TRUE, rotate.tree = 0, open.angle = 0, node.depth = 1, align.tip.label = FALSE, ...) ## S3 method for class 'multiPhylo' plot(x, layout = 1, ...)## S3 method for class 'phylo' plot(x, type = "phylogram", use.edge.length = TRUE, node.pos = NULL, show.tip.label = TRUE, show.node.label = FALSE, edge.color = NULL, edge.width = NULL, edge.lty = NULL, node.color = NULL, node.width = NULL, node.lty = NULL, font = 3, cex = par("cex"), adj = NULL, srt = 0, no.margin = FALSE, root.edge = FALSE, label.offset = 0, underscore = FALSE, x.lim = NULL, y.lim = NULL, direction = "rightwards", lab4ut = NULL, tip.color = par("col"), plot = TRUE, rotate.tree = 0, open.angle = 0, node.depth = 1, align.tip.label = FALSE, ...) ## S3 method for class 'multiPhylo' plot(x, layout = 1, ...)
x |
an object of class |
type |
a character string specifying the type of phylogeny to be drawn; it must be one of "phylogram" (the default), "cladogram", "fan", "unrooted", "radial", "tidy", or any unambiguous abbreviation of these. |
use.edge.length |
a logical indicating whether to use the edge
lengths of the phylogeny to draw the branches (the default) or not
(if |
node.pos |
a numeric taking the value 1 or 2 which specifies the
vertical position of the nodes with respect to their descendants. If
|
show.tip.label |
a logical indicating whether to show the tip
labels on the phylogeny (defaults to |
show.node.label |
a logical indicating whether to show the node
labels on the phylogeny (defaults to |
edge.color |
a vector of mode character giving the colours used
to draw the branches of the plotted phylogeny. These are taken to be
in the same order than the component |
edge.width |
a numeric vector giving the width of the branches of
the plotted phylogeny. These are taken to be in the same order than
the component |
edge.lty |
same as the previous argument but for line types; 1: plain, 2: dashed, 3: dotted, 4: dotdash, 5: longdash, 6: twodash. |
node.color |
a vector of mode character giving the colours used
to draw the perpendicular lines associated with each node of the
plotted phylogeny. These are taken to be
in the same order than the component |
node.width |
as the previous argument, but for line widths. |
node.lty |
as the previous argument, but for line types; 1: plain, 2: dashed, 3: dotted, 4: dotdash, 5: longdash, 6: twodash. |
font |
an integer specifying the type of font for the labels: 1 (plain text), 2 (bold), 3 (italic, the default), or 4 (bold italic). |
cex |
a numeric value giving the factor scaling of the tip and node labels (Character EXpansion). The default is to take the current value from the graphical parameters. |
adj |
a numeric specifying the justification of the text strings
of the labels: 0 (left-justification), 0.5 (centering), or 1
(right-justification). This option has no effect if |
srt |
a numeric giving how much the labels are rotated in degrees
(negative values are allowed resulting in clock-like rotation); the
value has an effect respectively to the value of
|
no.margin |
a logical. If |
root.edge |
a logical indicating whether to draw the root edge (defaults to FALSE); this has no effect if ‘use.edge.length = FALSE’ or if ‘type = "unrooted"’. |
label.offset |
a numeric giving the space between the nodes and
the tips of the phylogeny and their corresponding labels. This
option has no effect if |
underscore |
a logical specifying whether the underscores in tip
labels should be written as spaces (the default) or left as are (if
|
x.lim |
a numeric vector of length one or two giving the limit(s)
of the x-axis. If |
y.lim |
same than above for the y-axis. |
direction |
a character string specifying the direction of the tree. Four values are possible: "rightwards" (the default), "leftwards", "upwards", and "downwards". |
lab4ut |
(= labels for unrooted trees) a character string
specifying the display of tip labels for unrooted trees (can be
abbreviated): either |
tip.color |
the colours used for the tip labels, eventually recycled (see examples). |
plot |
a logical controlling whether to draw the tree. If
|
rotate.tree |
for "fan", "unrooted", or "radial" trees: the rotation of the whole tree in degrees (negative values are accepted). |
open.angle |
if |
node.depth |
an integer value (1 or 2) used if branch lengths are not used to plot the tree; 1: the node depths are proportional to the number of tips descending from each node (the default and was the only possibility previously), 2: they are evenly spaced. |
align.tip.label |
a logical value or an integer. If |
layout |
the number of trees to be plotted simultaneously. |
... |
further arguments to be passed to |
If x is a list of trees (i.e., an object of class
"multiPhylo"), then any further argument may be passed with
... and could be any one of those listed above for a single
tree.
The font format of the labels of the nodes and the tips is the same.
If no.margin = TRUE, the margins are set to zero and are not
restored after plotting the tree, so that the user can access the
coordinates system of the plot.
The option ‘node.pos’ allows the user to alter the vertical position
(i.e., ordinates) of the nodes. If node.pos = 1, then the
ordinate of a node is the mean of the ordinates of its direct
descendants (nodes and/or tips). If node.pos = 2, then the
ordinate of a node is the mean of the ordinates of all the tips of
which it is the ancestor. If node.pos = NULL (the default),
then its value is determined with respect to other options: if
type = "phylogram" then ‘node.pos = 1’; if type =
"cladogram" and use.edge.length = FALSE then ‘node.pos = 2’;
if type = "cladogram" and use.edge.length = TRUE then
‘node.pos = 1’. Remember that in this last situation, the branch
lengths make sense when projected on the x-axis.
If adj is not specified, then the value is determined with
respect to direction: if direction = "leftwards" then
adj = 1 (0 otherwise).
If the arguments x.lim and y.lim are not specified by the
user, they are determined roughly by the function. This may not always
give a nice result: the user may check these values with the
(invisibly) returned list (see “Value:”).
If you use align.tip.label = TRUE with type = "fan", you
will have certainly to set x.lim and y.lim manually.
If you resize manually the graphical device (windows or X11) you may need to replot the tree.
plot.phylo returns invisibly a list with the following
components which values are those used for the current plot:
type |
|
use.edge.length |
|
node.pos |
|
node.depth |
|
show.tip.label |
|
show.node.label |
|
font |
|
cex |
|
adj |
|
srt |
|
no.margin |
|
label.offset |
|
x.lim |
|
y.lim |
|
direction |
|
tip.color |
|
Ntip |
|
Nnode |
|
root.time |
|
align.tip.label |
The argument asp cannot be passed with ....
Emmanuel Paradis, Martin Smith, Damien de Vienne
van der Ploeg, A. (2014) Drawing non-layered tidy trees in linear time. Journal of Software: Practice and Experience, 44, 1467–1484.
read.tree, trex, kronoviz,
add.scale.bar, axisPhylo,
nodelabels, edges,
plot for the basic plotting function in R
### An extract from Sibley and Ahlquist (1990) x <- "(((Strix_aluco:4.2,Asio_otus:4.2):3.1,Athene_noctua:7.3):6.3,Tyto_alba:13.5);" tree.owls <- read.tree(text= x) plot(tree.owls) ### Show the types of trees. layout(matrix(1:6, 3, 2)) plot(tree.owls, main = "With branch lengths") plot(tree.owls, type = "c") plot(tree.owls, type = "u") plot(tree.owls, use.edge.length = FALSE, main = "Without branch lengths") plot(tree.owls, type = "c", use.edge.length = FALSE) plot(tree.owls, type = "u", use.edge.length = FALSE) layout(1) data(bird.orders) ### using random colours and thickness plot(bird.orders, edge.color = sample(colors(), length(bird.orders$edge)/2), edge.width = sample(1:10, length(bird.orders$edge)/2, replace = TRUE)) title("Random colours and branch thickness") ### rainbow colouring... X <- c("red", "orange", "yellow", "green", "blue", "purple") plot(bird.orders, edge.color = sample(X, length(bird.orders$edge)/2, replace = TRUE), edge.width = sample(1:10, length(bird.orders$edge)/2, replace = TRUE)) title("Rainbow colouring") plot(bird.orders, type = "c", use.edge.length = FALSE, edge.color = sample(X, length(bird.orders$edge)/2, replace = TRUE), edge.width = rep(5, length(bird.orders$edge)/2)) segments(rep(0, 6), 6.5:1.5, rep(2, 6), 6.5:1.5, lwd = 5, col = X) text(rep(2.5, 6), 6.5:1.5, paste(X, "..."), adj = 0) title("Character mapping...") plot(bird.orders, "u", font = 1, cex = 0.75) data(bird.families) plot(bird.families, "u", lab4ut = "axial", font = 1, cex = 0.5) plot(bird.families, "r", font = 1, cex = 0.5) ### cladogram with oblique tip labels plot(bird.orders, "c", FALSE, direction = "u", srt = -40, x.lim = 25.5) ### facing trees with different informations... tr <- bird.orders tr$tip.label <- rep("", 23) layout(matrix(1:2, 1, 2), c(5, 4)) plot(bird.orders, "c", FALSE, adj = 0.5, no.margin = TRUE, label.offset = 0.8, edge.color = sample(X, length(bird.orders$edge)/2, replace = TRUE), edge.width = rep(5, length(bird.orders$edge)/2)) text(7.5, 23, "Facing trees with\ndifferent informations", font = 2) plot(tr, "p", direction = "l", no.margin = TRUE, edge.width = sample(1:10, length(bird.orders$edge)/2, replace = TRUE)) ### Recycling of arguments gives a lot of possibilities ### for tip labels: plot(bird.orders, tip.col = c(rep("red", 5), rep("blue", 18)), font = c(rep(3, 5), rep(2, 17), 1)) plot(bird.orders, tip.col = c("blue", "green"), cex = 23:1/23 + .3, font = 1:3) co <- c(rep("blue", 9), rep("green", 35)) plot(bird.orders, "f", edge.col = co) plot(bird.orders, edge.col = co) layout(1) ## tidy trees tr <- rtree(100) layout(matrix(1:2, 2)) plot(tr) axis(2) plot(tr, "t") axis(2) ## around 20 percent gain on the y-axis### An extract from Sibley and Ahlquist (1990) x <- "(((Strix_aluco:4.2,Asio_otus:4.2):3.1,Athene_noctua:7.3):6.3,Tyto_alba:13.5);" tree.owls <- read.tree(text= x) plot(tree.owls) ### Show the types of trees. layout(matrix(1:6, 3, 2)) plot(tree.owls, main = "With branch lengths") plot(tree.owls, type = "c") plot(tree.owls, type = "u") plot(tree.owls, use.edge.length = FALSE, main = "Without branch lengths") plot(tree.owls, type = "c", use.edge.length = FALSE) plot(tree.owls, type = "u", use.edge.length = FALSE) layout(1) data(bird.orders) ### using random colours and thickness plot(bird.orders, edge.color = sample(colors(), length(bird.orders$edge)/2), edge.width = sample(1:10, length(bird.orders$edge)/2, replace = TRUE)) title("Random colours and branch thickness") ### rainbow colouring... X <- c("red", "orange", "yellow", "green", "blue", "purple") plot(bird.orders, edge.color = sample(X, length(bird.orders$edge)/2, replace = TRUE), edge.width = sample(1:10, length(bird.orders$edge)/2, replace = TRUE)) title("Rainbow colouring") plot(bird.orders, type = "c", use.edge.length = FALSE, edge.color = sample(X, length(bird.orders$edge)/2, replace = TRUE), edge.width = rep(5, length(bird.orders$edge)/2)) segments(rep(0, 6), 6.5:1.5, rep(2, 6), 6.5:1.5, lwd = 5, col = X) text(rep(2.5, 6), 6.5:1.5, paste(X, "..."), adj = 0) title("Character mapping...") plot(bird.orders, "u", font = 1, cex = 0.75) data(bird.families) plot(bird.families, "u", lab4ut = "axial", font = 1, cex = 0.5) plot(bird.families, "r", font = 1, cex = 0.5) ### cladogram with oblique tip labels plot(bird.orders, "c", FALSE, direction = "u", srt = -40, x.lim = 25.5) ### facing trees with different informations... tr <- bird.orders tr$tip.label <- rep("", 23) layout(matrix(1:2, 1, 2), c(5, 4)) plot(bird.orders, "c", FALSE, adj = 0.5, no.margin = TRUE, label.offset = 0.8, edge.color = sample(X, length(bird.orders$edge)/2, replace = TRUE), edge.width = rep(5, length(bird.orders$edge)/2)) text(7.5, 23, "Facing trees with\ndifferent informations", font = 2) plot(tr, "p", direction = "l", no.margin = TRUE, edge.width = sample(1:10, length(bird.orders$edge)/2, replace = TRUE)) ### Recycling of arguments gives a lot of possibilities ### for tip labels: plot(bird.orders, tip.col = c(rep("red", 5), rep("blue", 18)), font = c(rep(3, 5), rep(2, 17), 1)) plot(bird.orders, tip.col = c("blue", "green"), cex = 23:1/23 + .3, font = 1:3) co <- c(rep("blue", 9), rep("green", 35)) plot(bird.orders, "f", edge.col = co) plot(bird.orders, edge.col = co) layout(1) ## tidy trees tr <- rtree(100) layout(matrix(1:2, 2)) plot(tr) axis(2) plot(tr, "t") axis(2) ## around 20 percent gain on the y-axis
These are extra functions to plot and annotate phylogenies, mostly calling basic graphical functions in ape.
plotBreakLongEdges(phy, n = 1, ...) drawSupportOnEdges(value, ...)plotBreakLongEdges(phy, n = 1, ...) drawSupportOnEdges(value, ...)
phy |
an object of class |
n |
the numner of long branches to be broken. |
value |
the values to be printed on the internal branches of the tree. |
... |
further arguments to be passed to |
drawSupportOnEdges assumes the tree is unrooted, so the vector
value should have as many values than the number of internal
branches (= number of nodes - 1). If there is one additional value, it
is assumed that it relates to the root node and is dropped (see examples).
NULL
Emmanuel Paradis
plot.phylo, edgelabels,
boot.phylo, plotTreeTime
tr <- rtree(10) tr$edge.length[c(1, 18)] <- 100 op <- par(mfcol = 1:2) plot(tr); axisPhylo() plotBreakLongEdges(tr, 2); axisPhylo() ## from ?boot.phylo: f <- function(x) nj(dist.dna(x)) data(woodmouse) tw <- f(woodmouse) # NJ tree with K80 distance set.seed(1) ## bootstrap with 100 replications: (bp <- boot.phylo(tw, woodmouse, f, quiet = TRUE)) ## the first value relates to the root node and is always 100 ## it is ignored below: plot(tw, "u") drawSupportOnEdges(bp) ## more readable but the tree is really unrooted: plot(tw) drawSupportOnEdges(bp) par(op)tr <- rtree(10) tr$edge.length[c(1, 18)] <- 100 op <- par(mfcol = 1:2) plot(tr); axisPhylo() plotBreakLongEdges(tr, 2); axisPhylo() ## from ?boot.phylo: f <- function(x) nj(dist.dna(x)) data(woodmouse) tw <- f(woodmouse) # NJ tree with K80 distance set.seed(1) ## bootstrap with 100 replications: (bp <- boot.phylo(tw, woodmouse, f, quiet = TRUE)) ## the first value relates to the root node and is always 100 ## it is ignored below: plot(tw, "u") drawSupportOnEdges(bp) ## more readable but the tree is really unrooted: plot(tw) drawSupportOnEdges(bp) par(op)
Plot previously estimated variance components.
## S3 method for class 'varcomp' plot(x, xlab = "Levels", ylab = "Variance", type = "b", ...)## S3 method for class 'varcomp' plot(x, xlab = "Levels", ylab = "Variance", type = "b", ...)
x |
A varcomp object |
xlab |
x axis label |
ylab |
y axis label |
type |
plot type ("l", "p" or "b", see |
... |
Further argument sent to the |
The same as xyplot.
Julien Dutheil [email protected]
This function plots a non-ultrametric tree where the tips are not contemporary together with their dates on the x-axis.
plotTreeTime(phy, tip.dates, show.tip.label = FALSE, y.lim = NULL, color = TRUE, ...)plotTreeTime(phy, tip.dates, show.tip.label = FALSE, y.lim = NULL, color = TRUE, ...)
phy |
an object of class |
tip.dates |
a vector of the same length than the number of tips
in |
show.tip.label |
a logical value; see |
y.lim |
by default, one fifth of the plot is left below the tree; use this option to change this behaviour. |
color |
a logical value specifying whether to use colors for the
lines linking the tips to the time axis. If |
... |
other arguments to be passed to |
The vector tip.dates may be numeric or of class
“Date”. In either case, the time axis is set
accordingly. The length of this vector must be equal to the number of
tips of the tree: the dates are matched to the tips numbers. Missing
values are allowed.
NULL
Emmanuel Paradis
dates <- as.Date(.leap.seconds) tr <- rtree(length(dates)) plotTreeTime(tr, dates) ## handling NA's: dates[11:26] <- NA plotTreeTime(tr, dates) ## dates can be on an arbitrary scale, e.g., [-1, 1]: plotTreeTime(tr, runif(Ntip(tr), -1, 1))dates <- as.Date(.leap.seconds) tr <- rtree(length(dates)) plotTreeTime(tr, dates) ## handling NA's: dates[11:26] <- NA plotTreeTime(tr, dates) ## dates can be on an arbitrary scale, e.g., [-1, 1]: plotTreeTime(tr, runif(Ntip(tr), -1, 1))
These functions prints a compact summary of a phylogeny, or a list of phylogenies, on the console.
## S3 method for class 'phylo' print(x, printlen = 6 ,...) ## S3 method for class 'multiPhylo' print(x, details = FALSE ,...) ## S3 method for class 'multiPhylo' str(object, ...)## S3 method for class 'phylo' print(x, printlen = 6 ,...) ## S3 method for class 'multiPhylo' print(x, details = FALSE ,...) ## S3 method for class 'multiPhylo' str(object, ...)
x |
an object of class |
object |
an object of class |
printlen |
the number of labels to print (6 by default). |
details |
a logical indicating whether to print information on all trees. |
... |
further arguments passed to or from other methods. |
NULL.
Ben Bolker and Emmanuel Paradis
read.tree, summary.phylo,
print for the generic R function
x <- rtree(10) print(x) print(x, printlen = 10) x <- rmtree(2, 10) print(x) print(x, TRUE) str(x)x <- rtree(10) print(x) print(x, printlen = 10) x <- rmtree(2, 10) print(x) print(x, TRUE) str(x)
This function generates random sets of DNA sequences.
rDNAbin(n, nrow, ncol, base.freq = rep(0.25, 4), prefix = "Ind_")rDNAbin(n, nrow, ncol, base.freq = rep(0.25, 4), prefix = "Ind_")
n |
a vector of integers giving the lengths of the sequences. Can
be missing in which case |
nrow, ncol
|
two single integer values giving the number of
sequences and the number of sites, respectively (ignored if |
base.freq |
the base frequencies. |
prefix |
the prefix used to give labels to the sequences; by default these are Ind_1, ... Ind_n (or Ind_nrow). |
If n is used, this function generates a list with sequence lengths given by the values in n. If n is missing, a matrix is
generated.
The purpose of this function is to generate a set of sequences of a
specific size. To simulate sequences on a phylogenetic tree, see
simSeq in phangorn (very efficient), and
the package phylosim (more for pedagogy).
an object of class "DNAbin".
It is not recommended to use this function to generate objects larger than two billion bases (2 Gb).
Emmanuel Paradis
rDNAbin(1:10) rDNAbin(rep(10, 10)) rDNAbin(nrow = 10, ncol = 10)rDNAbin(1:10) rDNAbin(rep(10, 10)) rDNAbin(nrow = 10, ncol = 10)
These functions read DNA sequences in a file, and returns a matrix or a
list of DNA sequences with the names of the taxa read in the file as
rownames or names, respectively. By default, the sequences are returned
in binary format, otherwise (if as.character = TRUE) in
lowercase.
read.dna(file, format = "interleaved", skip = 0, nlines = 0, comment.char = "#", as.character = FALSE, as.matrix = NULL) read.FASTA(file, type = "DNA") read.fastq(file, offset = -33)read.dna(file, format = "interleaved", skip = 0, nlines = 0, comment.char = "#", as.character = FALSE, as.matrix = NULL) read.FASTA(file, type = "DNA") read.fastq(file, offset = -33)
file |
a file name specified by either a variable of mode character,
or a double-quoted string. Can also be a connection (which
will be opened for reading if necessary, and if so
|
format |
a character string specifying the format of the DNA
sequences. Four choices are possible: |
skip |
the number of lines of the input file to skip before beginning to read data (ignored for FASTA files; see below). |
nlines |
the number of lines to be read (by default the file is read untill its end; ignored for FASTA files)). |
comment.char |
a single character, the remaining of the line after this character is ignored (ignored for FASTA files). |
as.character |
a logical controlling whether to return the
sequences as an object of class |
as.matrix |
(used if |
type |
a character string giving the type of the sequences: one of
|
offset |
the value to be added to the quality scores (the default applies to the Sanger format and should work for most recent FASTQ files). |
read.dna follows the interleaved and sequential formats defined
in PHYLIP (Felsenstein, 1993) but with the original feature than there
is no restriction on the lengths of the taxa names. For these two
formats, the first line of the file must contain the dimensions of the
data (the numbers of taxa and the numbers of nucleotides); the
sequences are considered as aligned and thus must be of the same
lengths for all taxa. For the FASTA and FASTQ formats, the conventions
defined in the references are followed; the sequences are taken as
non-aligned. For all formats, the nucleotides can be arranged in any
way with blanks and line-breaks inside (with the restriction that the
first ten nucleotides must be contiguous for the interleaved and
sequential formats, see below). The names of the sequences are read in
the file. Particularities for each format are detailed below.
Interleaved: the function starts to read the sequences after it finds one or more spaces (or tabulations). All characters before the sequences are taken as the taxa names after removing the leading and trailing spaces (so spaces in taxa names are not allowed). It is assumed that the taxa names are not repeated in the subsequent blocks of nucleotides.
Sequential: the same criterion than for the interleaved format is used to start reading the sequences and the taxa names; the sequences are then read until the number of nucleotides specified in the first line of the file is reached. This is repeated for each taxa.
Clustal: this is the format output by the Clustal programs (.aln). It is close to the interleaved format: the differences are that the dimensions of the data are not indicated in the file, and the names of the sequences are repeated in each block.
FASTA: this looks like the sequential format but the taxa names (or a description of the sequence) are on separate lines beginning with a ‘greater than’ character ‘>’ (there may be leading spaces before this character). These lines are taken as taxa names after removing the ‘>’ and the possible leading and trailing spaces. All the data in the file before the first sequence are ignored.
The FASTQ format is explained in the references.
Compressed files must be read through connections (see examples).
read.fastq can read compressed files directly (see
examples).
a matrix or a list (if format = "fasta") of DNA sequences
stored in binary format, or of mode character (if as.character =
"TRUE").
read.FASTA always returns a list of class "DNAbin" or
"AAbin".
read.fastq returns a list of class "DNAbin" with an
atrribute "QUAL" (see examples).
Emmanuel Paradis and RJ Ewing
Anonymous. FASTA format. https://en.wikipedia.org/wiki/FASTA_format
Anonymous. FASTQ format. https://en.wikipedia.org/wiki/FASTQ_format
Felsenstein, J. (1993) Phylip (Phylogeny Inference Package) version 3.5c. Department of Genetics, University of Washington. http://evolution.genetics.washington.edu/phylip/phylip.html
read.GenBank, write.dna,
DNAbin, dist.dna, woodmouse
## 1. Simple text files TEXTfile <- tempfile("exdna", fileext = ".txt") ## 1a. Extract from data(woodmouse) in sequential format: cat("3 40", "No305 NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT", "No304 ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT", "No306 ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT", file = TEXTfile, sep = "\n") ex.dna <- read.dna(TEXTfile, format = "sequential") str(ex.dna) ex.dna ## 1b. The same data in interleaved format, ... cat("3 40", "No305 NTTCGAAAAA CACACCCACT", "No304 ATTCGAAAAA CACACCCACT", "No306 ATTCGAAAAA CACACCCACT", " ACTAAAANTT ATCAGTCACT", " ACTAAAAATT ATCAACCACT", " ACTAAAAATT ATCAATCACT", file = TEXTfile, sep = "\n") ex.dna2 <- read.dna(TEXTfile) ## 1c. ... in clustal format, ... cat("CLUSTAL (ape) multiple sequence alignment", "", "No305 NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT", "No304 ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT", "No306 ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT", " ************************** ****** ****", file = TEXTfile, sep = "\n") ex.dna3 <- read.dna(TEXTfile, format = "clustal") ## 1d. ... and in FASTA format FASTAfile <- tempfile("exdna", fileext = ".fas") cat(">No305", "NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT", ">No304", "ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT", ">No306", "ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT", file = FASTAfile, sep = "\n") ex.dna4 <- read.dna(FASTAfile, format = "fasta") ## The 4 data objects are the same: identical(ex.dna, ex.dna2) identical(ex.dna, ex.dna3) identical(ex.dna, ex.dna4) ## 2. How to read GZ compressed files ## create a GZ file and open a connection: GZfile <- tempfile("exdna", fileext = ".fas.gz") con <- gzfile(GZfile, "wt") ## write the data using the connection: cat(">No305", "NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT", ">No304", "ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT", ">No306", "ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT", file = con, sep = "\n") close(con) # close the connection ## read the GZ'ed file: ex.dna5 <- read.dna(gzfile(GZfile), "fasta") ## This example is with a FASTA file but this works as well ## with the other formats described above. ## All 5 data objects are identical: identical(ex.dna, ex.dna5) unlink(c(TEXTfile, FASTAfile, GZfile)) # clean-up ## Not run: ## 3. How to read files from a ZIP archive ## NOTE: since ape 5.7-1, all files in these examples are written ## in the temporary directory, thus the following commands work ## best when run in the user's working directory. ## write the woodmouse data in a FASTA file: data(woodmouse) write.dna(woodmouse, "woodmouse.fas", "fasta") ## archive a FASTA file in a ZIP file: zip("myarchive.zip", "woodmouse.fas") ## Note: the file myarchive.zip is created if necessary ## Read the FASTA file from the ZIP archive without extraction: wood2 <- read.dna(unz("myarchive.zip", "woodmouse.fas"), "fasta") ## Alternatively, unzip the archive: fl <- unzip("myarchive.zip") ## the previous command eventually creates locally ## the fullpath archived with 'woodmouse.fas' wood3 <- read.dna(fl, "fasta") identical(woodmouse, wood2) identical(woodmouse, wood3) ## End(Not run) ## read a FASTQ file from 1000 Genomes: ## Not run: a <- "https://ftp.1000genomes.ebi.ac.uk/vol1/ftp/phase3/data/HG00096/sequence_read/" file <- "SRR062641.filt.fastq.gz" URL <- paste0(a, file) download.file(URL, file) ## If the above command doesn't work, you may copy/paste URL in ## a Web browser instead. X <- read.fastq(file) X # 109,811 sequences ## get the qualities of the first sequence: (qual1 <- attr(X, "QUAL")[[1]]) ## the corresponding probabilities: 10^(-qual1/10) ## get the mean quality for each sequence: mean.qual <- sapply(attr(X, "Q"), mean) ## can do the same for var, sd, ... ## End(Not run)## 1. Simple text files TEXTfile <- tempfile("exdna", fileext = ".txt") ## 1a. Extract from data(woodmouse) in sequential format: cat("3 40", "No305 NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT", "No304 ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT", "No306 ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT", file = TEXTfile, sep = "\n") ex.dna <- read.dna(TEXTfile, format = "sequential") str(ex.dna) ex.dna ## 1b. The same data in interleaved format, ... cat("3 40", "No305 NTTCGAAAAA CACACCCACT", "No304 ATTCGAAAAA CACACCCACT", "No306 ATTCGAAAAA CACACCCACT", " ACTAAAANTT ATCAGTCACT", " ACTAAAAATT ATCAACCACT", " ACTAAAAATT ATCAATCACT", file = TEXTfile, sep = "\n") ex.dna2 <- read.dna(TEXTfile) ## 1c. ... in clustal format, ... cat("CLUSTAL (ape) multiple sequence alignment", "", "No305 NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT", "No304 ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT", "No306 ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT", " ************************** ****** ****", file = TEXTfile, sep = "\n") ex.dna3 <- read.dna(TEXTfile, format = "clustal") ## 1d. ... and in FASTA format FASTAfile <- tempfile("exdna", fileext = ".fas") cat(">No305", "NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT", ">No304", "ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT", ">No306", "ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT", file = FASTAfile, sep = "\n") ex.dna4 <- read.dna(FASTAfile, format = "fasta") ## The 4 data objects are the same: identical(ex.dna, ex.dna2) identical(ex.dna, ex.dna3) identical(ex.dna, ex.dna4) ## 2. How to read GZ compressed files ## create a GZ file and open a connection: GZfile <- tempfile("exdna", fileext = ".fas.gz") con <- gzfile(GZfile, "wt") ## write the data using the connection: cat(">No305", "NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT", ">No304", "ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT", ">No306", "ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT", file = con, sep = "\n") close(con) # close the connection ## read the GZ'ed file: ex.dna5 <- read.dna(gzfile(GZfile), "fasta") ## This example is with a FASTA file but this works as well ## with the other formats described above. ## All 5 data objects are identical: identical(ex.dna, ex.dna5) unlink(c(TEXTfile, FASTAfile, GZfile)) # clean-up ## Not run: ## 3. How to read files from a ZIP archive ## NOTE: since ape 5.7-1, all files in these examples are written ## in the temporary directory, thus the following commands work ## best when run in the user's working directory. ## write the woodmouse data in a FASTA file: data(woodmouse) write.dna(woodmouse, "woodmouse.fas", "fasta") ## archive a FASTA file in a ZIP file: zip("myarchive.zip", "woodmouse.fas") ## Note: the file myarchive.zip is created if necessary ## Read the FASTA file from the ZIP archive without extraction: wood2 <- read.dna(unz("myarchive.zip", "woodmouse.fas"), "fasta") ## Alternatively, unzip the archive: fl <- unzip("myarchive.zip") ## the previous command eventually creates locally ## the fullpath archived with 'woodmouse.fas' wood3 <- read.dna(fl, "fasta") identical(woodmouse, wood2) identical(woodmouse, wood3) ## End(Not run) ## read a FASTQ file from 1000 Genomes: ## Not run: a <- "https://ftp.1000genomes.ebi.ac.uk/vol1/ftp/phase3/data/HG00096/sequence_read/" file <- "SRR062641.filt.fastq.gz" URL <- paste0(a, file) download.file(URL, file) ## If the above command doesn't work, you may copy/paste URL in ## a Web browser instead. X <- read.fastq(file) X # 109,811 sequences ## get the qualities of the first sequence: (qual1 <- attr(X, "QUAL")[[1]]) ## the corresponding probabilities: 10^(-qual1/10) ## get the mean quality for each sequence: mean.qual <- sapply(attr(X, "Q"), mean) ## can do the same for var, sd, ... ## End(Not run)
This function connects to the GenBank database, and reads nucleotide sequences using accession numbers given as arguments.
read.GenBank(access.nb, seq.names = access.nb, species.names = TRUE, as.character = FALSE, chunk.size = 400, quiet = TRUE, type = "DNA") read.UniProt(access.nb, quiet = FALSE, chunk.size = 400)read.GenBank(access.nb, seq.names = access.nb, species.names = TRUE, as.character = FALSE, chunk.size = 400, quiet = TRUE, type = "DNA") read.UniProt(access.nb, quiet = FALSE, chunk.size = 400)
access.nb |
a vector of mode character giving the accession numbers. |
seq.names |
the names to give to each sequence; by default the accession numbers are used. |
species.names |
a logical indicating whether to attribute the species names to the returned object. |
as.character |
a logical controlling whether to return the
sequences as an object of class |
chunk.size |
the number of sequences downloaded together (see details). |
quiet |
a logical value indicating whether to show the progress
of the downloads. If |
type |
a character string specifying to download "DNA" (nucleotide) or "AA" (amino acid) sequences (can be upper- or lowercase). |
The first function uses the site https://www.ncbi.nlm.nih.gov/ from where the sequences are retrieved.
If species.names = TRUE, the returned list has an attribute
"species" containing the names of the species taken from the
field “ORGANISM” in GenBank.
Since ape 3.6, this function retrieves the sequences in FASTA
format: this is more efficient and more flexible (scaffolds and
contigs can be read) than what was done in previous versions. The
option gene.names has been removed in ape 5.4; this
information is also present in the description.
Setting species.names = FALSE is much faster (could be useful
if you read a series of scaffolds or contigs, or if you already have
the species names).
The argument chunk.size is set by default to 400 which is
likely to work in many cases. If an error occurs such as “Cannot open
file ...” showing the list of the accession numbers, then you may
try decreasing chunk.size to 200 or 300.
If quiet = FALSE, the display is done chunk by chunk, so the
message “Downloading sequences: 400 / 400 ...” means that the
download from sequence 1 to sequence 400 is under progress (it is not
possible to display a more accurate message because the download
method depends on the platform).
A list of DNA sequences made of vectors of class "DNAbin", or
of single characters (if as.character = TRUE) with two
attributes (species and description).
Emmanuel Paradis and Klaus Schliep
read.dna, write.dna,
dist.dna, DNAbin
## This won't work if your computer is not connected ## to the Internet ## Get the 8 sequences of tanagers (Ramphocelus) ## as used in Paradis (1997) ref <- c("U15717", "U15718", "U15719", "U15720", "U15721", "U15722", "U15723", "U15724") ## Copy/paste or type the following commands if you ## want to try them. ## Not run: Rampho <- read.GenBank(ref) ## get the species names: attr(Rampho, "species") ## build a matrix with the species names and the accession numbers: cbind(attr(Rampho, "species"), names(Rampho)) ## print the first sequence ## (can be done with `Rampho$U15717' as well) Rampho[[1]] ## the description from each FASTA sequence: attr(Rampho, "description") ## read sequences from UniProt acc <- c("A0A248QE08", "A0A9D4Z084", "A0A2P6V0Y7", "A0AAD5DYF2", "A0A2P6U1B6", "A0AAW1P9M4", "I0YJ13", "A0ABR2Z3P8", "A0A150GC51", "A0A836BBQ2") ra <- read.UniProt(acc) ra ## End(Not run)## This won't work if your computer is not connected ## to the Internet ## Get the 8 sequences of tanagers (Ramphocelus) ## as used in Paradis (1997) ref <- c("U15717", "U15718", "U15719", "U15720", "U15721", "U15722", "U15723", "U15724") ## Copy/paste or type the following commands if you ## want to try them. ## Not run: Rampho <- read.GenBank(ref) ## get the species names: attr(Rampho, "species") ## build a matrix with the species names and the accession numbers: cbind(attr(Rampho, "species"), names(Rampho)) ## print the first sequence ## (can be done with `Rampho$U15717' as well) Rampho[[1]] ## the description from each FASTA sequence: attr(Rampho, "description") ## read sequences from UniProt acc <- c("A0A248QE08", "A0A9D4Z084", "A0A2P6V0Y7", "A0AAD5DYF2", "A0A2P6U1B6", "A0AAW1P9M4", "I0YJ13", "A0ABR2Z3P8", "A0A150GC51", "A0A836BBQ2") ra <- read.UniProt(acc) ra ## End(Not run)
This function reads a file in general feature format version 3 (GFF3) and returns a data frame.
read.gff(file, na.strings = c(".", "?"), GFF3 = TRUE)read.gff(file, na.strings = c(".", "?"), GFF3 = TRUE)
file |
a file name specified by a character string. |
na.strings |
the strings in the GFF file that will be converted as NA's (missing values). |
GFF3 |
a logical value specifying whether if the file is formatted according to version 3 of GFF. |
The returned data frame has its (column) names correctly set (see References) and the categorical variables (seqid, source, type, strand, and phase) set as factors.
This function should be more efficient than using read.delim.
GFF2 (aka GTF) files can also be read: use GFF3 = FALSE to have
the correct field names. Note that GFF2 files and GFF3 files have the
same structure, although some fields are slightly different (see
reference).
The file can be gz-compressed (see examples), but not zipped.
NULL
Emmanuel Paradis
https://en.wikipedia.org/wiki/General_feature_format
## Not run: ## requires to be connected on Internet d <- "https://ftp.ensembl.org/pub/release-86/gff3/homo_sapiens/" f <- "Homo_sapiens.GRCh38.86.chromosome.MT.gff3.gz" download.file(paste0(d, f), "mt_gff3.gz") ## If the above command doesn't work, you may copy/paste the full URL in ## a Web browser instead. gff.mito <- read.gff("mt_gff3.gz") ## the lengths of the sequence features: gff.mito$end - (gff.mito$start - 1) table(gff.mito$type) ## where the exons start: gff.mito$start[gff.mito$type == "exon"] ## End(Not run)## Not run: ## requires to be connected on Internet d <- "https://ftp.ensembl.org/pub/release-86/gff3/homo_sapiens/" f <- "Homo_sapiens.GRCh38.86.chromosome.MT.gff3.gz" download.file(paste0(d, f), "mt_gff3.gz") ## If the above command doesn't work, you may copy/paste the full URL in ## a Web browser instead. gff.mito <- read.gff("mt_gff3.gz") ## the lengths of the sequence features: gff.mito$end - (gff.mito$start - 1) table(gff.mito$type) ## where the exons start: gff.mito$start[gff.mito$type == "exon"] ## End(Not run)
This function reads one or several trees in a NEXUS file.
read.nexus(file, tree.names = NULL, force.multi = FALSE)read.nexus(file, tree.names = NULL, force.multi = FALSE)
file |
a file name specified by either a variable of mode character, or a double-quoted string. |
tree.names |
if there are several trees to be read, a vector of mode character giving names to the individual trees (by default, this uses the labels in the NEXUS file if these are present). |
force.multi |
a logical value; if |
The present implementation tries to follow as much as possible the
NEXUS standard. Only the block “TREES” is read; the other data can
be read with other functions (e.g., read.dna,
read.table, ...).
Until ape version 5.8-1, if a TRANSLATION table was present it
was assumed that only the tip labels are translated with integers
without gap and nodes labels were not looked for in the translation
table. Recent versions of ape now conforms more closely to the
NEXUS standard as described in Maddison et al (1997). Note that
write.nexus translates only the tip labels.
Using force.multi = TRUE when the file contains a single tree
makes possible to keep the tree name (as names of the list).
‘read.nexus’ tries to represent correctly trees with a badly represented root edge (i.e. with an extra pair of parentheses). For instance, the tree "((A:1,B:1):10);" will be read like "(A:1,B:1):10;" but a warning message will be issued in the former case as this is apparently not a valid Newick format. If there are two root edges (e.g., "(((A:1,B:1):10):10);"), then the tree is not read and an error message is issued.
an object of class "phylo" or "multiPhylo".
NEXUS is not a particularly efficient format to store very large
collections of trees. For 1000 trees each with 1000 tips, the NEXUS
file is (roughly) 30 MB, and it takes 5 sec to read it with this
function. The file can be compressed with GZIP making it about twice
smaller for about the same time to read it (thanks to the ability of
scan to read directly compressed files). On the
other hand, saving the same list of trees with
saveRDS creates a file of about 20 MB which can be
read with readRDS in 0.2 sec.
Emmanuel Paradis
Maddison, D. R., Swofford, D. L. and Maddison, W. P. (1997) NEXUS: an extensible file format for systematic information. Systematic Biology, 46, 590–621.
read.tree, write.nexus,
write.tree, read.nexus.data,
write.nexus.data
read.nexus.data reads a file with sequences in the NEXUS
format. nexus2DNAbin is a helper function to convert the output
from the previous function into the class "DNAbin".
For the moment, only sequence data (DNA or protein) are supported.
read.nexus.data(file) nexus2DNAbin(x)read.nexus.data(file) nexus2DNAbin(x)
file |
a file name specified by either a variable of mode character, or a double-quoted string. |
x |
an object output by |
This parser tries to read data from a file written in a restricted NEXUS format (see examples below).
Please see files ‘data.nex’ and ‘taxacharacters.nex’ for examples of formats that will work.
Some noticeable exceptions from the NEXUS standard (non-exhaustive list):
I: Comments must be either on separate lines or at the
end of lines. Examples:[Comment] — OKTaxon ACGTACG [Comment] — OK[Comment line 1
Comment line 2] — NOT OK!Tax[Comment]on ACG[Comment]T — NOT OK!
II: No spaces (or comments) are allowed in the
sequences. Examples:name ACGT — OKname AC GT — NOT OK!
III: No spaces are allowed in taxon names, not even if
names are in single quotes. That is, single-quoted names are not
treated as such by the parser. Examples:Genus_species — OK'Genus_species' — OK'Genus species' — NOT OK!
IV: The trailing end that closes the
matrix must be on a separate line. Examples:taxon AACCGGT
end; — OKtaxon AACCGGT;
end; — OKtaxon AACCCGT; end; — NOT OK!
V: Multistate characters are not allowed. That is,
NEXUS allows you to specify multiple character states at a
character position either as an uncertainty, (XY), or as an
actual appearance of multiple states, {XY}. This is
information is not handled by the parser. Examples:taxon 0011?110 — OKtaxon 0011{01}110 — NOT OK!taxon 0011(01)110 — NOT OK!
VI: The number of taxa must be on the same line as
ntax. The same applies to nchar. Examples:ntax = 12 — OKntax =
12 — NOT OK!
VII: The word “matrix” can not occur anywhere in
the file before the actual matrix command, unless it is in
a comment. Examples:BEGIN CHARACTERS;
TITLE 'Data in file "03a-cytochromeB.nex"';
DIMENSIONS NCHAR=382;
FORMAT DATATYPE=Protein GAP=- MISSING=?;
["This is The Matrix"] — OK
MATRIX
BEGIN CHARACTERS;
TITLE 'Matrix in file "03a-cytochromeB.nex"'; — NOT OK!
DIMENSIONS NCHAR=382;
FORMAT DATATYPE=Protein GAP=- MISSING=?;
MATRIX
A list of sequences each made of a single vector of mode character where each element is a (phylogenetic) character state.
Johan Nylander, Thomas Guillerme, and Klaus Schliep
Maddison, D. R., Swofford, D. L. and Maddison, W. P. (1997) NEXUS: an extensible file format for systematic information. Systematic Biology, 46, 590–621.
read.nexus, write.nexus,
write.nexus.data
## Use read.nexus.data to read a file in NEXUS format into object x ## Not run: x <- read.nexus.data("file.nex")## Use read.nexus.data to read a file in NEXUS format into object x ## Not run: x <- read.nexus.data("file.nex")
This function reads a file which contains one or several trees in parenthetic format known as the Newick or New Hampshire format.
read.tree(file = "", text = NULL, tree.names = NULL, skip = 0, comment.char = "", keep.multi = FALSE, evonet = FALSE)read.tree(file = "", text = NULL, tree.names = NULL, skip = 0, comment.char = "", keep.multi = FALSE, evonet = FALSE)
file |
a file name specified by either a variable of mode character,
or a double-quoted string; if |
text |
alternatively, the name of a variable of mode character
which contains the tree(s) in parenthetic format. By default, this
is ignored (set to |
tree.names |
if there are several trees to be read, a vector of
mode character that gives names to the individual trees; if
|
skip |
the number of lines of the input file to skip before
beginning to read data (this is passed directly to |
comment.char |
a single character, the remaining of the line
after this character is ignored (this is passed directly to
|
keep.multi |
if |
evonet |
if |
The default option for file allows to type directly the tree on
the keyboard (or possibly to copy from an editor and paste in R's
console) with, e.g., mytree <- read.tree().
‘read.tree’ tries to represent correctly trees with a badly represented root edge (i.e. with an extra pair of parentheses). For instance, the tree "((A:1,B:1):10);" will be read like "(A:1,B:1):10;" but a warning message will be issued in the former case as this is apparently not a valid Newick format.
If there are any characters preceding the first "(" in a line then
this is assigned to the name of the tree. This is returned when a
"multiPhylo" object is returned and tree.names = NULL.
Until ape 4.1, the default of comment.char was "#"
(as in read.table()). This has been changed so that extended
Newick files can be read.
an object of class "phylo" with the following components:
edge |
a two-column matrix of mode numeric where each row represents an edge of the tree; the nodes and the tips are symbolized with numbers; the tips are numbered 1, 2, ..., and the nodes are numbered after the tips. For each row, the first column gives the ancestor. |
edge.length |
(optional) a numeric vector giving the lengths of the
branches given by |
tip.label |
a vector of mode character giving the names of the
tips; the order of the names in this vector corresponds to the
(positive) number in |
Nnode |
the number of (internal) nodes. |
node.label |
(optional) a vector of mode character giving the names of the nodes. |
root.edge |
(optional) a numeric value giving the length of the branch at the root if it exists. |
If several trees are read in the file, the returned object is of class
"multiPhylo", and is a list of objects of class "phylo".
The name of each tree can be specified by tree.names, or can be
read from the file (see details).
Emmanuel Paradis and Daniel Lawson [email protected]
Felsenstein, J. The Newick tree format. https://phylipweb.github.io/phylip/newicktree.html
Olsen, G. (1990) Interpretation of the "Newick's 8:45" tree format standard. https://phylipweb.github.io/phylip/newick_doc.html
Paradis, E. (2020) Definition of Formats for Coding Phylogenetic Trees in R. https://emmanuelparadis.github.io/misc/FormatTreeR.pdf
write.tree, read.nexus,
write.nexus, scan for the basic R
function to read data in a file
### An extract from Sibley and Ahlquist (1990) s <- "owls(((Strix_aluco:4.2,Asio_otus:4.2):3.1,Athene_noctua:7.3):6.3,Tyto_alba:13.5);" treefile <- tempfile("tree", fileext = ".tre") cat(s, file = treefile, sep = "\n") tree.owls <- read.tree(treefile) str(tree.owls) tree.owls tree.owls <- read.tree(treefile, keep.multi = TRUE) tree.owls names(tree.owls) unlink(treefile) # clean-up ### Only the first three species using the option `text' TREE <- "((Strix_aluco:4.2,Asio_otus:4.2):3.1,Athene_noctua:7.3);" TREE tree.owls.bis <- read.tree(text = TREE) str(tree.owls.bis) tree.owls.bis ## tree with singleton nodes: ts <- read.tree(text = "((((a))),d);") plot(ts, node.depth = 2) # the default will overlap the singleton node with the tip nodelabels() ## 'skeleton' tree with a singleton node: tx <- read.tree(text = "(((,)),);") plot(tx, node.depth = 2) nodelabels() ## a tree with single quoted labels (the 2nd label is not quoted ## because it has no white spaces): z <- "(('a: France, Spain (Europe)',b),'c: Australia [Outgroup]');" tz <- read.tree(text = z) plot(tz, font = 1)### An extract from Sibley and Ahlquist (1990) s <- "owls(((Strix_aluco:4.2,Asio_otus:4.2):3.1,Athene_noctua:7.3):6.3,Tyto_alba:13.5);" treefile <- tempfile("tree", fileext = ".tre") cat(s, file = treefile, sep = "\n") tree.owls <- read.tree(treefile) str(tree.owls) tree.owls tree.owls <- read.tree(treefile, keep.multi = TRUE) tree.owls names(tree.owls) unlink(treefile) # clean-up ### Only the first three species using the option `text' TREE <- "((Strix_aluco:4.2,Asio_otus:4.2):3.1,Athene_noctua:7.3);" TREE tree.owls.bis <- read.tree(text = TREE) str(tree.owls.bis) tree.owls.bis ## tree with singleton nodes: ts <- read.tree(text = "((((a))),d);") plot(ts, node.depth = 2) # the default will overlap the singleton node with the tip nodelabels() ## 'skeleton' tree with a singleton node: tx <- read.tree(text = "(((,)),);") plot(tx, node.depth = 2) nodelabels() ## a tree with single quoted labels (the 2nd label is not quoted ## because it has no white spaces): z <- "(('a: France, Spain (Europe)',b),'c: Australia [Outgroup]');" tz <- read.tree(text = z) plot(tz, font = 1)
This function estimates ancestral character states, and the associated uncertainty, for continuous characters. It mainly works as the ace function, from which it differs, first, in the fact that computations are not performed by numerical optimisation but through matrix calculus. Second, besides classical Brownian-based reconstruction methods, it reconstructs ancestral states under Arithmetic Brownian Motion (ABM, i.e. Brownian with linear trend) and Ornstein-Uhlenbeck process (OU, i.e. Brownian with an attractive optimum).
reconstruct(x, phyInit, method = "ML", alpha = NULL, low_alpha = 0.0001, up_alpha = 1, CI = TRUE)reconstruct(x, phyInit, method = "ML", alpha = NULL, low_alpha = 0.0001, up_alpha = 1, CI = TRUE)
x |
a numerical vector. |
phyInit |
an object of class |
method |
a character specifying the method used for
estimation. Six choices are possible: |
alpha |
a numerical value which accounts for the attractive strength parameter of |
low_alpha |
a lower bound for alpha, used only with methods |
up_alpha |
an upper bound for alpha, used only with methods |
CI |
a logical specifying whether to return the 95% confidence intervals of the ancestral state estimates. |
For "ML", "REML" and "GLS", the default model is Brownian motion. This model
can be fitted by maximum
likelihood (method = "ML", Felsenstein 1973, Schluter et al. 1997) - the default, residual maximum likelihood (method = "REML"), or generalized least
squares (method = "GLS", Martins and Hansen 1997, Garland T and Ives AR 2000).
"GLS_ABM" is based on Brownian motion with trend model. Both "GLS_OU" and "GLS_OUS" are based on Ornstein-Uhlenbeck model.
"GLS_OU" and "GLS_OUS" differs in the fact that "GLS_OUS" assume that the process starts from the optimum, while the root state has to be estimated for "GLS_OU", which may rise some issues (see Royer-Carenzi and Didier, 2016). Users may provide the attractive strength parameter alpha, for these two models.
"GLS_ABM", "GLS_OU" and "GLS_OUS" are all fitted by generalized least squares (Royer-Carenzi and Didier, 2016).
an object of class "ace" with the following elements:
ace |
the estimates of the ancestral character values. |
CI95 |
the estimated 95% confidence intervals. |
sigma2 |
if
|
loglik |
if |
GLS_ABM should not be used on ultrametric tree.
GLS_OU may lead to aberrant reconstructions.
Manuela Royer-Carenzi, Gilles Didier
Felsenstein, J. (1973) Maximum likelihood estimation of evolutionary trees from continuous characters. American Journal of Human Genetics, 25, 471–492.
Garland T. and Ives A.R. (2000) Using the past to predict the present: confidence intervals for regression equations in phylogenetic comparative methods. American Naturalist, 155, 346–364.
Martins, E. P. and Hansen, T. F. (1997) Phylogenies and the comparative method: a general approach to incorporating phylogenetic information into the analysis of interspecific data. American Naturalist, 149, 646–667.
Royer-Carenzi, M. and Didier, G. (2016) A comparison of ancestral state reconstruction methods for quantitative characters. Journal of Theoretical Biology, 404, 126–142.
Schluter, D., Price, T., Mooers, A. O. and Ludwig, D. (1997) Likelihood of ancestor states in adaptive radiation. Evolution, 51, 1699–1711.
Yang, Z. (2006) Computational Molecular Evolution. Oxford: Oxford University Press.
Reconstruction of ancestral sequences can be done with the package
phangorn (see function ?ancestral.pml).
### Some random data... data(bird.orders) x <- rnorm(23, m=100) ### Reconstruct ancestral quantitative characters: reconstruct(x, bird.orders) reconstruct(x, bird.orders, method = "GLS_OUS", alpha=NULL)### Some random data... data(bird.orders) x <- rnorm(23, m=100) ### Reconstruct ancestral quantitative characters: reconstruct(x, bird.orders) reconstruct(x, bird.orders, method = "GLS_OUS", alpha=NULL)
reorder changes the internal structure of a phylogeny stored as
an object of class "phylo". The tree returned is the same than
the one input, but the ordering of the edges could be different.
cladewise and postorder are convenience functions to
return only the indices of the reordered edge matrices (see examples).
## S3 method for class 'phylo' reorder(x, order = "cladewise", index.only = FALSE, ...) ## S3 method for class 'multiPhylo' reorder(x, order = "cladewise", ...) cladewise(x) postorder(x)## S3 method for class 'phylo' reorder(x, order = "cladewise", index.only = FALSE, ...) ## S3 method for class 'multiPhylo' reorder(x, order = "cladewise", ...) cladewise(x) postorder(x)
x |
an object of class |
order |
a character string: either |
index.only |
should the function return only the ordered indices of the rows of the edge matrix? |
... |
further arguments passed to or from other methods. |
Because in a tree coded as an object of class "phylo" each
branch is represented by a row in the element ‘edge’, there is an
arbitrary choice for the ordering of these rows. reorder allows
to reorder these rows according to three rules: in the
"cladewise" order each clade is formed by a series of
contiguous rows. In the "postorder" order, the rows are
arranged so that computations following pruning-like algorithm the
tree (or postorder tree traversal) can be done by descending along
these rows (conversely, a preorder tree traversal can be performed by
moving from the last to the first row). The "pruningwise" order
is an alternative “pruning” order which is actually a bottom-up
traversal order (Valiente 2002). (This third choice might be removed
in the future as it merely duplicates the second one which is more
efficient.) The possible multichotomies and branch lengths are preserved.
Note that for a given order, there are several possible orderings of the rows of ‘edge’.
an object of class "phylo" (with the attribute "order"
set accordingly), or a numeric vector if index.only = TRUE; if
x is of class "multiPhylo", then an object of the same
class.
Emmanuel Paradis
Valiente, G. (2002) Algorithms on Trees and Graphs. New York: Springer.
read.tree to read tree files in Newick format,
reorder for the generic function
data(bird.families) tr <- reorder(bird.families, "postorder") all.equal(bird.families, tr) # uses all.equal.phylo actually all.equal.list(bird.families, tr) # bypasses the generic ## get the number of descendants for each tip or node: nr_desc <- function(x) { res <- numeric(max(x$edge)) res[1:Ntip(x)] <- 1L for (i in postorder(x)) { tmp <- x$edge[i,1] res[tmp] <- res[tmp] + res[x$edge[i, 2]] } res } ## apply it to a random tree: tree <- rtree(10) plot(tree, show.tip.label = FALSE) tiplabels() nodelabels() nr_desc(tree)data(bird.families) tr <- reorder(bird.families, "postorder") all.equal(bird.families, tr) # uses all.equal.phylo actually all.equal.list(bird.families, tr) # bypasses the generic ## get the number of descendants for each tip or node: nr_desc <- function(x) { res <- numeric(max(x$edge)) res[1:Ntip(x)] <- 1L for (i in postorder(x)) { tmp <- x$edge[i,1] res[tmp] <- res[tmp] + res[x$edge[i, 2]] } res } ## apply it to a random tree: tree <- rtree(10) plot(tree, show.tip.label = FALSE) tiplabels() nodelabels() nr_desc(tree)
This function performs a test of shift in diversification rate using probabilities from the Yule process.
richness.yule.test(x, t)richness.yule.test(x, t)
x |
a matrix or a data frame with at least two columns: the first one gives the number of species in clades with a trait supposed to increase or decrease diversification rate, and the second one the number of species in the sister-clades without the trait. Each row represents a pair of sister-clades. |
t |
a numeric vector giving the divergence times of each pair of
clades in |
a data frame with the , the number of degrees of
freedom (= 1), and the P-value.
Emmanuel Paradis
Paradis, E. (2012) Shift in diversification in sister-clade comparisons: a more powerful test. Evolution, 66, 288–295.
slowinskiguyer.test, mcconwaysims.test,
diversity.contrast.test
### see example(mcconwaysims.test)### see example(mcconwaysims.test)
These three functions simulate phylogenies under any time-dependent
birth–death model: rlineage generates a complete tree including
the species going extinct before present; rbdtree generates a
tree with only the species living at present (thus the tree is
ultrametric); rphylo generates a tree with a fixed number of
species at present time. drop.fossil is a utility function to
remove the extinct species.
rlineage(birth, death, Tmax = 50, BIRTH = NULL, DEATH = NULL, eps = 1e-6) rbdtree(birth, death, Tmax = 50, BIRTH = NULL, DEATH = NULL, eps = 1e-6) rphylo(n, birth, death, BIRTH = NULL, DEATH = NULL, T0 = 50, fossils = FALSE, eps = 1e-06) drop.fossil(phy, tol = 1e-8)rlineage(birth, death, Tmax = 50, BIRTH = NULL, DEATH = NULL, eps = 1e-6) rbdtree(birth, death, Tmax = 50, BIRTH = NULL, DEATH = NULL, eps = 1e-6) rphylo(n, birth, death, BIRTH = NULL, DEATH = NULL, T0 = 50, fossils = FALSE, eps = 1e-06) drop.fossil(phy, tol = 1e-8)
birth, death
|
a numeric value or a (vectorized) function specifying how speciation and extinction rates vary through time. |
Tmax |
a numeric value giving the length of the simulation. |
BIRTH, DEATH
|
a (vectorized) function which is the primitive
of |
eps |
a numeric value giving the time resolution of the simulation; this may be increased (e.g., 0.001) to shorten computation times. |
n |
the number of species living at present time. |
T0 |
the time at present (for the backward-in-time algorithm). |
fossils |
a logical value specifying whether to output the lineages going extinct. |
phy |
an object of class |
tol |
a numeric value giving the tolerance to consider a species as extinct. |
These three functions use continuous-time algorithms: rlineage
and rbdtree use the forward-in-time algorithms described in
Paradis (2011), whereas rphylo uses a backward-in-time
algorithm from Stadler (2011). The models are time-dependent
birth–death models as described in Kendall (1948). Speciation
(birth) and extinction (death) rates may be constant or vary through
time according to an R function specified by the user. In the latter
case, BIRTH and/or DEATH may be used if the primitives
of birth and death are known. In these functions time is
the formal argument and must be named t.
Note that rphylo simulates trees in a way similar to what
the package TreeSim does, the difference is in the
parameterization of the time-dependent models which is here the same
than used in the two other functions. In this parameterization scheme,
time is measured from past to present (see details in Paradis 2015
which includes a comparison of these algorithms).
The difference between rphylo and rphylo(... fossils
= TRUE) is the same than between rbdtree and rlineage.
An object of class "phylo".
Emmanuel Paradis
Kendall, D. G. (1948) On the generalized “birth-and-death” process. Annals of Mathematical Statistics, 19, 1–15.
Paradis, E. (2011) Time-dependent speciation and extinction from phylogenies: a least squares approach. Evolution, 65, 661–672.
Paradis, E. (2015) Random phylogenies and the distribution of branching times. Journal of Theoretical Biology, 387, 39–45.
Stadler, T. (2011) Simulating trees with a fixed number of extant species. Systematic Biology, 60, 676–684.
yule, yule.time, birthdeath,
rtree, stree
set.seed(10) plot(rlineage(0.1, 0)) # Yule process with lambda = 0.1 plot(rlineage(0.1, 0.05)) # simple birth-death process b <- function(t) 1/(1 + exp(0.2*t - 1)) # logistic layout(matrix(0:3, 2, byrow = TRUE)) curve(b, 0, 50, xlab = "Time", ylab = "") mu <- 0.07 segments(0, mu, 50, mu, lty = 2) legend("topright", c(expression(lambda), expression(mu)), lty = 1:2, bty = "n") plot(rlineage(b, mu), show.tip.label = FALSE) title("Simulated with 'rlineage'") plot(rbdtree(b, mu), show.tip.label = FALSE) title("Simulated with 'rbdtree'")set.seed(10) plot(rlineage(0.1, 0)) # Yule process with lambda = 0.1 plot(rlineage(0.1, 0.05)) # simple birth-death process b <- function(t) 1/(1 + exp(0.2*t - 1)) # logistic layout(matrix(0:3, 2, byrow = TRUE)) curve(b, 0, 50, xlab = "Time", ylab = "") mu <- 0.07 segments(0, mu, 50, mu, lty = 2) legend("topright", c(expression(lambda), expression(mu)), lty = 1:2, bty = "n") plot(rlineage(b, mu), show.tip.label = FALSE) title("Simulated with 'rlineage'") plot(rbdtree(b, mu), show.tip.label = FALSE) title("Simulated with 'rbdtree'")
root reroots a phylogenetic tree with respect to the specified
outgroup or at the node specified in node.
unroot unroots a phylogenetic tree, or returns it unchanged if
it is already unrooted.
is.rooted tests whether a tree is rooted.
root(phy, ...) ## S3 method for class 'phylo' root(phy, outgroup, node = NULL, resolve.root = FALSE, interactive = FALSE, edgelabel = FALSE, ...) ## S3 method for class 'multiPhylo' root(phy, outgroup, ...) unroot(phy, ...) ## S3 method for class 'phylo' unroot(phy, collapse.singles = FALSE, keep.root.edge = FALSE, ...) ## S3 method for class 'multiPhylo' unroot(phy, collapse.singles = FALSE, keep.root.edge = FALSE, ...) is.rooted(phy) ## S3 method for class 'phylo' is.rooted(phy) ## S3 method for class 'multiPhylo' is.rooted(phy)root(phy, ...) ## S3 method for class 'phylo' root(phy, outgroup, node = NULL, resolve.root = FALSE, interactive = FALSE, edgelabel = FALSE, ...) ## S3 method for class 'multiPhylo' root(phy, outgroup, ...) unroot(phy, ...) ## S3 method for class 'phylo' unroot(phy, collapse.singles = FALSE, keep.root.edge = FALSE, ...) ## S3 method for class 'multiPhylo' unroot(phy, collapse.singles = FALSE, keep.root.edge = FALSE, ...) is.rooted(phy) ## S3 method for class 'phylo' is.rooted(phy) ## S3 method for class 'multiPhylo' is.rooted(phy)
phy |
an object of class |
outgroup |
a vector of mode numeric or character specifying the new outgroup. |
node |
alternatively, a node number where to root the tree. |
resolve.root |
a logical specifying whether to resolve the new root as a bifurcating node. |
interactive |
if |
edgelabel |
a logical value specifying whether to treat node
labels as edge labels and thus eventually switching them so that
they are associated with the correct edges when using
|
collapse.singles |
a logical value specifying wether to call
|
keep.root.edge |
a logical value. If |
... |
arguments passed among methods (e.g., when rooting lists of trees). |
The argument outgroup can be either character or numeric. In
the first case, it gives the labels of the tips of the new outgroup;
in the second case the numbers of these labels in the vector
phy$tip.label are given.
If outgroup is of length one (i.e., a single value), then the
tree is rerooted using the node below this tip as the new root.
If outgroup is of length two or more, the most recent common
ancestor (MRCA) of the ingroup is used as the new root. Note
that the tree is unrooted before being rerooted, so that if
outgroup is already the outgroup, then the returned tree is not
the same than the original one (see examples). If outgroup is
not monophyletic, the operation fails and an error message is issued.
If resolve.root = TRUE, root adds a zero-length branch
below the MRCA of the ingroup.
A tree is considered rooted if either only two branches connect to the
root, or if there is a root.edge element. In all other cases,
is.rooted returns FALSE.
an object of class "phylo" or "multiPhylo" for
root and unroot; a logical vector for is.rooted.
The use of resolve.root = TRUE together with node =
gives an error if the specified node is the current root of the
tree. This is because there is an ambiguity when resolving a node in
an unrooted tree with no explicit outgroup. If the node is not the
current root, the ambiguity is solved arbitrarily by considering the
clade on the right of node (when the tree is plotted by
default) as the ingroup. See a detailed explanation there:
https://www.mail-archive.com/[email protected]/msg03805.html.
Emmanuel Paradis
Czech, L., Huerta-Cepas, J. and Stamatakis, A. (2017) A critical review on the use of support values in tree viewers and bioinformatics toolkits. Molecular Biology and Evolution, 34, 1535–1542. doi:10.1093/molbev/msx055
bind.tree, drop.tip,
nodelabels, identify.phylo
data(bird.orders) plot(root(bird.orders, 1)) plot(root(bird.orders, 1:5)) tr <- root(bird.orders, 1) is.rooted(bird.orders) # yes is.rooted(tr) # no ### This is because the tree has been unrooted first before rerooting. ### You can delete the outgroup... is.rooted(drop.tip(tr, "Struthioniformes")) ### ... or resolve the basal trichotomy in two ways: is.rooted(multi2di(tr)) is.rooted(root(bird.orders, 1, r = TRUE)) ### To keep the basal trichotomy but forcing the tree as rooted: tr$root.edge <- 0 is.rooted(tr) x <- setNames(rmtree(10, 10), LETTERS[1:10]) is.rooted(x)data(bird.orders) plot(root(bird.orders, 1)) plot(root(bird.orders, 1:5)) tr <- root(bird.orders, 1) is.rooted(bird.orders) # yes is.rooted(tr) # no ### This is because the tree has been unrooted first before rerooting. ### You can delete the outgroup... is.rooted(drop.tip(tr, "Struthioniformes")) ### ... or resolve the basal trichotomy in two ways: is.rooted(multi2di(tr)) is.rooted(root(bird.orders, 1, r = TRUE)) ### To keep the basal trichotomy but forcing the tree as rooted: tr$root.edge <- 0 is.rooted(tr) x <- setNames(rmtree(10, 10), LETTERS[1:10]) is.rooted(x)
For a given node, rotate exchanges the position of two clades
descending from this node. It can handle dichotomies as well as
polytomies. In the latter case, two clades from the polytomy are
selected for swapping.
rotateConstr rotates internal branches giving a constraint on
the order of the tips.
rotate(phy, node, polytom = c(1, 2)) rotateConstr(phy, constraint)rotate(phy, node, polytom = c(1, 2)) rotateConstr(phy, constraint)
phy |
an object of class |
node |
a vector of mode numeric or character specifying the number of the node. |
polytom |
a vector of mode numeric and length two specifying the two clades that should be exchanged in a polytomy. |
constraint |
a vector of mode character specifying the order of the tips as they should appear when plotting the tree (from bottom to top). |
phy can be either rooted or unrooted, contain polytomies and lack
branch lengths. In the presence of very short branch lengths it is
convenient to plot the phylogenetic tree without branch lengths in order
to identify the number of the node in question.
node can be any of the interior nodes of a phylogenetic tree
including the root node. Number of the nodes can be identified by the
nodelabels function. Alternatively, you can specify a vector of length
two that contains either the number or the names of two tips that
coalesce in the node of interest.
If the node subtends a polytomy, any two clades of the the polytomy can be chosen by polytom. On a plotted phylogeny, the clades are numbered from bottom to top and polytom is used to index the two clades one likes to swop.
an object of class "phylo".
Christoph Heibl [email protected], Emmanuel Paradis
plot.phylo, nodelabels,
root, drop.tip
# create a random tree: tre <- rtree(25) # visualize labels of internal nodes: plot(tre, use.edge.length=FALSE) nodelabels() # rotate clades around node 30: tre.new <- rotate(tre, 30) # compare the results: par(mfrow=c(1,2)) # split graphical device plot(tre) # plot old tre plot(tre.new) # plot new tree # visualize labels of terminal nodes: plot(tre) tiplabels() # rotate clades containing nodes 12 and 20: tre.new <- rotate(tre, c(12, 21)) # compare the results: par(mfrow=c(1,2)) # split graphical device plot(tre) # plot old tre plot(tre.new) # plot new tree # or you migth just specify tiplabel names: tre.new <- rotate(tre, c("t3", "t14")) # compare the results: par(mfrow=c(1,2)) # devide graphical device plot(tre) # plot old tre plot(tre.new) # plot new tree # a simple example for rotateConstr: A <- read.tree(text = "((A,B),(C,D));") B <- read.tree(text = "(((D,C),B),A);") B <- rotateConstr(B, A$tip.label) plot(A); plot(B, d = "l") # something more interesting (from ?cophyloplot): tr1 <- rtree(40) ## drop 20 randomly chosen tips: tr2 <- drop.tip(tr1, sample(tr1$tip.label, size = 20)) ## rotate the root and reorder the whole: tr2 <- rotate(tr2, 21) tr2 <- read.tree(text = write.tree(tr2)) X <- cbind(tr2$tip.label, tr2$tip.label) # association matrix cophyloplot(tr1, tr2, assoc = X, space = 28) ## before reordering tr2 we have to find the constraint: co <- tr2$tip.label[order(match(tr2$tip.label, tr1$tip.label))] newtr2 <- rotateConstr(tr2, co) cophyloplot(tr1, newtr2, assoc = X, space = 28)# create a random tree: tre <- rtree(25) # visualize labels of internal nodes: plot(tre, use.edge.length=FALSE) nodelabels() # rotate clades around node 30: tre.new <- rotate(tre, 30) # compare the results: par(mfrow=c(1,2)) # split graphical device plot(tre) # plot old tre plot(tre.new) # plot new tree # visualize labels of terminal nodes: plot(tre) tiplabels() # rotate clades containing nodes 12 and 20: tre.new <- rotate(tre, c(12, 21)) # compare the results: par(mfrow=c(1,2)) # split graphical device plot(tre) # plot old tre plot(tre.new) # plot new tree # or you migth just specify tiplabel names: tre.new <- rotate(tre, c("t3", "t14")) # compare the results: par(mfrow=c(1,2)) # devide graphical device plot(tre) # plot old tre plot(tre.new) # plot new tree # a simple example for rotateConstr: A <- read.tree(text = "((A,B),(C,D));") B <- read.tree(text = "(((D,C),B),A);") B <- rotateConstr(B, A$tip.label) plot(A); plot(B, d = "l") # something more interesting (from ?cophyloplot): tr1 <- rtree(40) ## drop 20 randomly chosen tips: tr2 <- drop.tip(tr1, sample(tr1$tip.label, size = 20)) ## rotate the root and reorder the whole: tr2 <- rotate(tr2, 21) tr2 <- read.tree(text = write.tree(tr2)) X <- cbind(tr2$tip.label, tr2$tip.label) # association matrix cophyloplot(tr1, tr2, assoc = X, space = 28) ## before reordering tr2 we have to find the constraint: co <- tr2$tip.label[order(match(tr2$tip.label, tr1$tip.label))] newtr2 <- rotateConstr(tr2, co) cophyloplot(tr1, newtr2, assoc = X, space = 28)
This function simulates the evolution of a continuous character along a phylogeny. The calculation is done recursively from the root. See Paradis (2012, pp. 232 and 324) for an introduction.
rTraitCont(phy, model = "BM", sigma = 0.1, alpha = 1, theta = 0, ancestor = FALSE, root.value = 0, ...)rTraitCont(phy, model = "BM", sigma = 0.1, alpha = 1, theta = 0, ancestor = FALSE, root.value = 0, ...)
phy |
an object of class |
model |
a character (either |
sigma |
a numeric vector giving the standard-deviation of the random component for each branch (can be a single value). |
alpha |
if |
theta |
if |
ancestor |
a logical value specifying whether to return the values at the nodes as well (by default, only the values at the tips are returned). |
root.value |
a numeric giving the value at the root. |
... |
further arguments passed to |
There are three possibilities to specify model:
"BM": a Browian motion model is used. If the arguments
sigma has more than one value, its length must be equal to the
the branches of the tree. This allows to specify a model with variable
rates of evolution. You must be careful that branch numbering is done
with the tree in “postorder” order: to see the order of the branches
you can use: tr <- reorder(tr, "po"); plor(tr); edgelabels().
The arguments alpha and theta are ignored.
"OU": an Ornstein-Uhlenbeck model is used. The above
indexing rule is used for the three parameters sigma,
alpha, and theta. This may be interesting for the last
one to model varying phenotypic optima. The exact updating formula
from Gillespie (1996) are used which are reduced to BM formula if
alpha = 0.
A function: it must be of the form foo(x, l) where
x is the trait of the ancestor and l is the branch
length. It must return the value of the descendant. The arguments
sigma, alpha, and theta are ignored.
A numeric vector with names taken from the tip labels of
phy. If ancestor = TRUE, the node labels are used if
present, otherwise, “Node1”, “Node2”, etc.
Emmanuel Paradis
Gillespie, D. T. (1996) Exact numerical simulation of the Ornstein-Uhlenbeck process and its integral. Physical Review E, 54, 2084–2091.
Paradis, E. (2012) Analysis of Phylogenetics and Evolution with R (Second Edition). New York: Springer.
data(bird.orders) rTraitCont(bird.orders) # BM with sigma = 0.1 ### OU model with two optima: tr <- reorder(bird.orders, "postorder") plot(tr) edgelabels() theta <- rep(0, Nedge(tr)) theta[c(1:4, 15:16, 23:24)] <- 2 ## sensitive to 'alpha' and 'sigma': rTraitCont(tr, "OU", theta = theta, alpha=.1, sigma=.01) ### an imaginary model with stasis 0.5 time unit after a node, then ### BM evolution with sigma = 0.1: foo <- function(x, l) { if (l <= 0.5) return(x) x + (l - 0.5)*rnorm(1, 0, 0.1) } tr <- rcoal(20, br = runif) rTraitCont(tr, foo, ancestor = TRUE) ### a cumulative Poisson process: bar <- function(x, l) x + rpois(1, l) (x <- rTraitCont(tr, bar, ancestor = TRUE)) plot(tr, show.tip.label = FALSE) Y <- x[1:20] A <- x[-(1:20)] nodelabels(A) tiplabels(Y)data(bird.orders) rTraitCont(bird.orders) # BM with sigma = 0.1 ### OU model with two optima: tr <- reorder(bird.orders, "postorder") plot(tr) edgelabels() theta <- rep(0, Nedge(tr)) theta[c(1:4, 15:16, 23:24)] <- 2 ## sensitive to 'alpha' and 'sigma': rTraitCont(tr, "OU", theta = theta, alpha=.1, sigma=.01) ### an imaginary model with stasis 0.5 time unit after a node, then ### BM evolution with sigma = 0.1: foo <- function(x, l) { if (l <= 0.5) return(x) x + (l - 0.5)*rnorm(1, 0, 0.1) } tr <- rcoal(20, br = runif) rTraitCont(tr, foo, ancestor = TRUE) ### a cumulative Poisson process: bar <- function(x, l) x + rpois(1, l) (x <- rTraitCont(tr, bar, ancestor = TRUE)) plot(tr, show.tip.label = FALSE) Y <- x[1:20] A <- x[-(1:20)] nodelabels(A) tiplabels(Y)
This function simulates the evolution of a discrete character along a
phylogeny. If model is a character or a matrix, evolution is
simulated with a Markovian model; the transition probabilities are
calculated for each branch with where is the
rate matrix given by model and is the branch length.
The calculation is done recursively from the root. See Paradis (2006,
p. 101) for a general introduction applied to evolution.
rTraitDisc(phy, model = "ER", k = if (is.matrix(model)) ncol(model) else 2, rate = 0.1, states = LETTERS[1:k], freq = rep(1/k, k), ancestor = FALSE, root.value = 1, ...)rTraitDisc(phy, model = "ER", k = if (is.matrix(model)) ncol(model) else 2, rate = 0.1, states = LETTERS[1:k], freq = rep(1/k, k), ancestor = FALSE, root.value = 1, ...)
phy |
an object of class |
model |
a character, a square numeric matrix, or a function specifying the model (see details). |
k |
the number of states of the character. |
rate |
the rate of change used if |
states |
the labels used for the states; by default “A”, “B”, ... |
freq |
a numeric vector giving the equilibrium relative frequencies of each state; by default the frequencies are equal. |
ancestor |
a logical value specifying whether to return the values at the nodes as well (by default, only the values at the tips are returned). |
root.value |
an integer giving the value at the root (by default,
it's the first state). To have a random value, use |
... |
further arguments passed to |
There are three possibilities to specify model:
A matrix: it must be a numeric square matrix; the diagonal is
always ignored. The arguments k and rate are ignored.
A character: these are the same short-cuts than in the function
ace: "ER" is an equal-rates model, "ARD"
is an all-rates-different model, and "SYM" is a symmetrical
model. Note that the argument rate must be of the appropriate
length, i.e., 1, , or for the three models,
respectively. The rate matrix is then filled column-wise.
A function: it must be of the form foo(x, l) where
x is the trait of the ancestor and l is the branch
length. It must return the value of the descendant as an integer.
A factor with names taken from the tip labels of phy. If
ancestor = TRUE, the node labels are used if present,
otherwise, “Node1”, “Node2”, etc.
Emmanuel Paradis
Paradis, E. (2006) Analyses of Phylogenetics and Evolution with R. New York: Springer.
data(bird.orders) ### the two followings are the same: rTraitDisc(bird.orders) rTraitDisc(bird.orders, model = matrix(c(0, 0.1, 0.1, 0), 2)) ### two-state model with irreversibility: rTraitDisc(bird.orders, model = matrix(c(0, 0, 0.1, 0), 2)) ### simple two-state model: tr <- rcoal(n <- 40, br = runif) x <- rTraitDisc(tr, ancestor = TRUE) plot(tr, show.tip.label = FALSE) nodelabels(pch = 19, col = x[-(1:n)]) tiplabels(pch = 19, col = x[1:n]) ### an imaginary model with stasis 0.5 time unit after a node, then ### random evolution: foo <- function(x, l) { if (l < 0.5) return(x) sample(2, size = 1) } tr <- rcoal(20, br = runif) x <- rTraitDisc(tr, foo, ancestor = TRUE) plot(tr, show.tip.label = FALSE) co <- c("blue", "yellow") cot <- c("white", "black") Y <- x[1:20] A <- x[-(1:20)] nodelabels(A, bg = co[A], col = cot[A]) tiplabels(Y, bg = co[Y], col = cot[Y])data(bird.orders) ### the two followings are the same: rTraitDisc(bird.orders) rTraitDisc(bird.orders, model = matrix(c(0, 0.1, 0.1, 0), 2)) ### two-state model with irreversibility: rTraitDisc(bird.orders, model = matrix(c(0, 0, 0.1, 0), 2)) ### simple two-state model: tr <- rcoal(n <- 40, br = runif) x <- rTraitDisc(tr, ancestor = TRUE) plot(tr, show.tip.label = FALSE) nodelabels(pch = 19, col = x[-(1:n)]) tiplabels(pch = 19, col = x[1:n]) ### an imaginary model with stasis 0.5 time unit after a node, then ### random evolution: foo <- function(x, l) { if (l < 0.5) return(x) sample(2, size = 1) } tr <- rcoal(20, br = runif) x <- rTraitDisc(tr, foo, ancestor = TRUE) plot(tr, show.tip.label = FALSE) co <- c("blue", "yellow") cot <- c("white", "black") Y <- x[1:20] A <- x[-(1:20)] nodelabels(A, bg = co[A], col = cot[A]) tiplabels(Y, bg = co[Y], col = cot[Y])
This function simulates the evolution of a multivariate set of traits along a phylogeny. The calculation is done recursively from the root.
rTraitMult(phy, model, p = 1, root.value = rep(0, p), ancestor = FALSE, asFactor = NULL, trait.labels = paste("x", 1:p, sep = ""), ...)rTraitMult(phy, model, p = 1, root.value = rep(0, p), ancestor = FALSE, asFactor = NULL, trait.labels = paste("x", 1:p, sep = ""), ...)
phy |
an object of class |
model |
a function specifying the model (see details). |
p |
an integer giving the number of traits. |
root.value |
a numeric vector giving the values at the root. |
ancestor |
a logical value specifying whether to return the values at the nodes as well (by default, only the values at the tips are returned). |
asFactor |
the indices of the traits that are returned as factors (discrete traits). |
trait.labels |
a vector of mode character giving the names of the traits. |
... |
further arguments passed to |
The model is specified with an R function of the form foo(x,
l) where x is a vector of the traits of the ancestor and
l is the branch length. Other arguments may be added. The
function must return a vector of length p.
A data frame with p columns whose names are given by
trait.labels and row names taken from the labels of the tree.
Emmanuel Paradis
## correlated evolution of 2 continuous traits: mod <- function(x, l) { y1 <- rnorm(1, x[1] + 0.5*x[2], 0.1) y2 <- rnorm(1, 0.5*x[1] + x[2], 0.1) c(y1, y2) } set.seed(11) tr <- makeNodeLabel(rcoal(20)) x <- rTraitMult(tr, mod, 2, ancestor = TRUE) op <- par(mfcol = c(2, 1)) plot(x, type = "n") text(x, labels = rownames(x), cex = 0.7) oq <- par(mar = c(0, 1, 0, 1), xpd = TRUE) plot(tr, font = 1, cex = 0.7) nodelabels(tr$node.label, cex = 0.7, adj = 1) par(c(op, oq))## correlated evolution of 2 continuous traits: mod <- function(x, l) { y1 <- rnorm(1, x[1] + 0.5*x[2], 0.1) y2 <- rnorm(1, 0.5*x[1] + x[2], 0.1) c(y1, y2) } set.seed(11) tr <- makeNodeLabel(rcoal(20)) x <- rTraitMult(tr, mod, 2, ancestor = TRUE) op <- par(mfcol = c(2, 1)) plot(x, type = "n") text(x, labels = rownames(x), cex = 0.7) oq <- par(mar = c(0, 1, 0, 1), xpd = TRUE) plot(tr, font = 1, cex = 0.7) nodelabels(tr$node.label, cex = 0.7, adj = 1) par(c(op, oq))
These functions generate trees by splitting randomly the edges
(rtree and rtopology) or randomly clustering the tips
(rcoal). rtree and rtopology generate general
trees, and rcoal generates coalescent trees. The algorithms are
described in Paradis (2012) and in a vignette in this package.
rtree(n, rooted = TRUE, tip.label = NULL, br = runif, equiprob = FALSE, ...) rtopology(n, rooted = FALSE, tip.label = NULL, br = runif, ...) rcoal(n, tip.label = NULL, br = "coalescent", ...) rmtree(N, n, rooted = TRUE, tip.label = NULL, br = runif, equiprob = FALSE, ...) rmtopology(N, n, rooted = FALSE, tip.label = NULL, br = runif, ...)rtree(n, rooted = TRUE, tip.label = NULL, br = runif, equiprob = FALSE, ...) rtopology(n, rooted = FALSE, tip.label = NULL, br = runif, ...) rcoal(n, tip.label = NULL, br = "coalescent", ...) rmtree(N, n, rooted = TRUE, tip.label = NULL, br = runif, equiprob = FALSE, ...) rmtopology(N, n, rooted = FALSE, tip.label = NULL, br = runif, ...)
n |
an integer giving the number of tips in the tree. |
rooted |
a logical indicating whether the tree should be rooted (the default). |
tip.label |
a character vector giving the tip labels; if not specified, the tips "t1", "t2", ..., are given. |
br |
one of the following: (i) an R function used to generate the
branch lengths ( |
equiprob |
(new since ape 5.4-1) a logical specifying
whether topologies are generated in equal frequencies. If,
|
... |
further argument(s) to be passed to |
N |
an integer giving the number of trees to generate. |
The trees generated are bifurcating. If rooted = FALSE in
(rtree), the tree is trifurcating at its root.
The option equiprob = TRUE generates unlabelled
topologies in equal frequencies. This is more complicated for the
labelled topologies (see the vignette “RandomTopologies”).
The default function to generate branch lengths in rtree is
runif. If further arguments are passed to br, they need
to be tagged (e.g., min = 0, max = 10).
rmtree calls successively rtree and set the class of
the returned object appropriately.
An object of class "phylo" or of class "multiPhylo" in
the case of rmtree or rmtopology.
Emmanuel Paradis
Paradis, E. (2012) Analysis of Phylogenetics and Evolution with R (Second Edition). New York: Springer.
stree, rlineage, vignette
“RandomTopologies”.
layout(matrix(1:9, 3, 3)) ### Nine random trees: for (i in 1:9) plot(rtree(20)) ### Nine random cladograms: for (i in 1:9) plot(rtree(20, FALSE), type = "c") ### generate 4 random trees of bird orders: data(bird.orders) layout(matrix(1:4, 2, 2)) for (i in 1:4) plot(rcoal(23, tip.label = bird.orders$tip.label), no.margin = TRUE) layout(1) par(mar = c(5, 4, 4, 2))layout(matrix(1:9, 3, 3)) ### Nine random trees: for (i in 1:9) plot(rtree(20)) ### Nine random cladograms: for (i in 1:9) plot(rtree(20, FALSE), type = "c") ### generate 4 random trees of bird orders: data(bird.orders) layout(matrix(1:4, 2, 2)) for (i in 1:4) plot(rcoal(23, tip.label = bird.orders$tip.label), no.margin = TRUE) layout(1) par(mar = c(5, 4, 4, 2))
This function roots a phylogenetic tree with dated tips in the location most compatible with the assumption of a strict molecular clock.
rtt(t, tip.dates, ncpu = 1, objective = correlation, opt.tol = .Machine$double.eps^0.25)rtt(t, tip.dates, ncpu = 1, objective = correlation, opt.tol = .Machine$double.eps^0.25)
t |
an object of class |
tip.dates |
a vector of sampling times associated to the tips of
|
ncpu |
number of cores to use. |
objective |
one of |
opt.tol |
tolerance for optimization precision. |
This function duplicates one part the functionality of the program Path-O-Gen (see references). The root position is chosen to produce the best linear regression of root-to-tip distances against sampling times.
t must have branch lengths in units of expected substitutions
per site.
tip.dates should be a vector of sampling times, in any time
unit, with time increasing toward the present. For example, this may
be in units of “days since study start” or “years since 10,000
BCE”, but not “millions of yearsago”.
Setting ncpu to a value larger than 1 requires the parallel
library.
objective is the measure which will be used to define the
“goodness” of a regression fit. It may be one of "correlation"
(strongest correlation between tip date and distance from root),
"rms" (lowest root-mean-squared error), or "rsquared"
(highest R-squared value).
opt.tol is used to optimize the location of the root along the best
branch. By default, R's optimize function uses a precision of
.Machine$double.eps^0.25, which is about 0.0001 on a 64-bit system.
This should be set to a smaller value if the branch lengths of t are
very short.
an object of class "phylo".
This function only chooses the best root. It does not rescale the branch lengths to time, or perform a statistical test of the molecular clock hypothesis.
Rosemary McCloskey[email protected], Emmanuel Paradis
Rambaut, A. (2009). Path-O-Gen: temporal signal investigation tool.
Rambaut, A. (2000). Estimating the rate of molecular evolution: incorporating non-contemporaneous sequences into maximum likelihood phylogenies. Bioinformatics, 16, 395-399.
t <- rtree(100) tip.date <- rnorm(t$tip.label)^2 rtt(t, tip.date)t <- rtree(100) tip.date <- rnorm(t$tip.label)^2 rtt(t, tip.date)
This function implements the SDM method of Criscuolo et al. (2006) for a set of n distance matrices.
SDM(...)SDM(...)
... |
2n elements (with n > 1), the first n elements are the
distance matrices: these can be (symmetric) matrices, objects of
class |
Reconstructs a consensus distance matrix from a set of input distance
matrices on overlapping sets of taxa. Potentially missing values in
the supermatrix are represented by NA. An error is returned if
the input distance matrices can not resolve to a consensus matrix.
a 2-element list containing a distance matrix labelled by the union of the set of taxa of the input distance matrices, and a variance matrix associated to the returned distance matrix.
Andrei Popescu
Criscuolo, A., Berry, V., Douzery, E. J. P. , and Gascuel, O. (2006) SDM: A fast distance-based approach for (super)tree building in phylogenomics. Systematic Biology, 55, 740–755.
bionj, fastme, njs,
mvrs, triangMtd
This function gives the indices of segregating (polymorphic) sites in a sample of DNA sequences.
seg.sites(x, strict = FALSE, trailingGapsAsN = TRUE)seg.sites(x, strict = FALSE, trailingGapsAsN = TRUE)
x |
a matrix or a list which contains the DNA sequences. |
strict |
a logical value; if |
trailingGapsAsN |
a logical value; if |
If the sequences are in a list, they must all be of the same length.
If strict = FALSE (the default), the following rule is used to
determine if a site is polymorphic or not in the presence of ambiguous
bases: ‘A’ and ‘R’ are not interpreted as different, ‘A’ and ‘Y’ are
interpreted as different, and ‘N’ and any other base (ambiguous or
not) are interpreted as not different. If strict = TRUE, all
letters are considered different.
Alignment gaps are considered different from all letters except for
the leading and trailing gaps if trailingGapsAsN = TRUE (which
is the default).
A numeric (integer) vector giving the indices of the segregating sites.
Emmanuel Paradis
base.freq, theta.s, nuc.div (last two in pegas)
data(woodmouse) y <- seg.sites(woodmouse) y length(y)data(woodmouse) y <- seg.sites(woodmouse) y length(y)
skyline computes the generalized skyline plot estimate of effective population size
from an estimated phylogeny. The demographic history is approximated by
a step-function. The number of parameters of the skyline plot (i.e. its smoothness)
is controlled by a parameter epsilon.
find.skyline.epsilon searches for an optimal value of the epsilon parameter,
i.e. the value that maximizes the AICc-corrected log-likelihood (logL.AICc).
skyline(x, ...) ## S3 method for class 'phylo' skyline(x, ...) ## S3 method for class 'coalescentIntervals' skyline(x, epsilon=0, ...) ## S3 method for class 'collapsedIntervals' skyline(x, old.style=FALSE, ...) find.skyline.epsilon(ci, GRID=1000, MINEPS=1e-6, ...)skyline(x, ...) ## S3 method for class 'phylo' skyline(x, ...) ## S3 method for class 'coalescentIntervals' skyline(x, epsilon=0, ...) ## S3 method for class 'collapsedIntervals' skyline(x, old.style=FALSE, ...) find.skyline.epsilon(ci, GRID=1000, MINEPS=1e-6, ...)
x |
Either an ultrametric tree (i.e. an object of class
|
epsilon |
collapsing parameter that controls the amount of smoothing
(allowed range: from |
old.style |
Parameter to choose between two slightly different variants of the
generalized skyline plot (Strimmer and Pybus, pers. comm.). The default value |
ci |
coalescent intervals (i.e. an object of class |
GRID |
Parameter for the grid search for |
MINEPS |
Parameter for the grid search for |
... |
Any of the above parameters. |
skyline implements the generalized skyline plot introduced in
Strimmer and Pybus (2001). For epsilon = 0 the
generalized skyline plot degenerates to the
classic skyline plot described in
Pybus et al. (2000). The latter is in turn directly related to lineage-through-time plots
(Nee et al., 1995).
skyline returns an object of class "skyline" with the following entries:
time |
A vector with the time at the end of each coalescent interval (i.e. the accumulated interval lengths from the beginning of the first interval to the end of an interval) |
interval.length |
A vector with the length of each interval. |
population.size |
A vector with the effective population size of each interval. |
parameter.count |
Number of free parameters in the skyline plot. |
epsilon |
The value of the underlying smoothing parameter. |
logL |
Log-likelihood of skyline plot (see Strimmer and Pybus, 2001). |
logL.AICc |
AICc corrected log-likelihood (see Strimmer and Pybus, 2001). |
find.skyline.epsilon returns the value of the epsilon parameter
that maximizes logL.AICc.
Korbinian Strimmer
Strimmer, K. and Pybus, O. G. (2001) Exploring the demographic history of DNA sequences using the generalized skyline plot. Molecular Biology and Evolution, 18, 2298–2305.
Pybus, O. G, Rambaut, A. and Harvey, P. H. (2000) An integrated framework for the inference of viral population history from reconstructed genealogies. Genetics, 155, 1429–1437.
Nee, S., Holmes, E. C., Rambaut, A. and Harvey, P. H. (1995) Inferring population history from molecular phylogenies. Philosophical Transactions of the Royal Society of London. Series B. Biological Sciences, 349, 25–31.
coalescent.intervals, collapsed.intervals,
skylineplot, ltt.plot.
# get tree data("hivtree.newick") # example tree in NH format tree.hiv <- read.tree(text = hivtree.newick) # load tree # corresponding coalescent intervals ci <- coalescent.intervals(tree.hiv) # from tree # collapsed intervals cl1 <- collapsed.intervals(ci,0) cl2 <- collapsed.intervals(ci,0.0119) #### classic skyline plot #### sk1 <- skyline(cl1) # from collapsed intervals sk1 <- skyline(ci) # from coalescent intervals sk1 <- skyline(tree.hiv) # from tree sk1 plot(skyline(tree.hiv)) skylineplot(tree.hiv) # shortcut plot(sk1, show.years=TRUE, subst.rate=0.0023, present.year = 1997) #### generalized skyline plot #### sk2 <- skyline(cl2) # from collapsed intervals sk2 <- skyline(ci, 0.0119) # from coalescent intervals sk2 <- skyline(tree.hiv, 0.0119) # from tree sk2 plot(sk2) # classic and generalized skyline plot together in one plot plot(sk1, show.years=TRUE, subst.rate=0.0023, present.year = 1997, col=c(grey(.8),1)) lines(sk2, show.years=TRUE, subst.rate=0.0023, present.year = 1997) legend(.15,500, c("classic", "generalized"), col=c(grey(.8),1),lty=1) # find optimal epsilon parameter using AICc criterion find.skyline.epsilon(ci) sk3 <- skyline(ci, -1) # negative epsilon also triggers estimation of epsilon sk3$epsilon# get tree data("hivtree.newick") # example tree in NH format tree.hiv <- read.tree(text = hivtree.newick) # load tree # corresponding coalescent intervals ci <- coalescent.intervals(tree.hiv) # from tree # collapsed intervals cl1 <- collapsed.intervals(ci,0) cl2 <- collapsed.intervals(ci,0.0119) #### classic skyline plot #### sk1 <- skyline(cl1) # from collapsed intervals sk1 <- skyline(ci) # from coalescent intervals sk1 <- skyline(tree.hiv) # from tree sk1 plot(skyline(tree.hiv)) skylineplot(tree.hiv) # shortcut plot(sk1, show.years=TRUE, subst.rate=0.0023, present.year = 1997) #### generalized skyline plot #### sk2 <- skyline(cl2) # from collapsed intervals sk2 <- skyline(ci, 0.0119) # from coalescent intervals sk2 <- skyline(tree.hiv, 0.0119) # from tree sk2 plot(sk2) # classic and generalized skyline plot together in one plot plot(sk1, show.years=TRUE, subst.rate=0.0023, present.year = 1997, col=c(grey(.8),1)) lines(sk2, show.years=TRUE, subst.rate=0.0023, present.year = 1997) legend(.15,500, c("classic", "generalized"), col=c(grey(.8),1),lty=1) # find optimal epsilon parameter using AICc criterion find.skyline.epsilon(ci) sk3 <- skyline(ci, -1) # negative epsilon also triggers estimation of epsilon sk3$epsilon
These functions provide various ways to draw skyline plot graphs
on the current graphical device. Note that skylineplot(z, ...) is simply
a shortcut for plot(skyline(z, ...)).
The skyline plot itself is an estimate of effective population size through time,
and is computed using the function skyline.
## S3 method for class 'skyline' plot(x, show.years=FALSE, subst.rate, present.year, ...) ## S3 method for class 'skyline' lines(x, show.years=FALSE, subst.rate, present.year, ...) skylineplot(z, ...) skylineplot.deluxe(tree, ...)## S3 method for class 'skyline' plot(x, show.years=FALSE, subst.rate, present.year, ...) ## S3 method for class 'skyline' lines(x, show.years=FALSE, subst.rate, present.year, ...) skylineplot(z, ...) skylineplot.deluxe(tree, ...)
x |
skyline plot data (i.e. an object of class |
z |
Either an ultrametric tree (i.e. an object of class |
tree |
ultrametric tree (i.e. an object of class |
show.years |
option that determines whether the time is plotted in units of of substitutions (default) or in years (requires specification of substution rate and year of present). |
subst.rate |
substitution rate (see option show.years). |
present.year |
present year (see option show.years). |
... |
further arguments to be passed on to |
See skyline for more details (incl. references) about the skyline plot method.
Korbinian Strimmer
plot and lines for the basic plotting
function in R, coalescent.intervals, skyline
# get tree data("hivtree.newick") # example tree in NH format tree.hiv <- read.tree(text = hivtree.newick) # load tree #### classic skyline plot skylineplot(tree.hiv) # shortcut #### plot classic and generalized skyline plots and estimate epsilon sk.opt <- skylineplot.deluxe(tree.hiv) sk.opt$epsilon #### classic and generalized skyline plot #### sk1 <- skyline(tree.hiv) sk2 <- skyline(tree.hiv, 0.0119) # use years rather than substitutions as unit for the time axis plot(sk1, show.years=TRUE, subst.rate=0.0023, present.year = 1997, col=c(grey(.8),1)) lines(sk2, show.years=TRUE, subst.rate=0.0023, present.year = 1997) legend(.15,500, c("classic", "generalized"), col=c(grey(.8),1),lty=1) #### various skyline plots for different epsilons layout(matrix(1:6, 2, 3, TRUE)) ci <- coalescent.intervals(tree.hiv) plot(skyline(ci, 0.0));title(main="0.0") plot(skyline(ci, 0.007));title(main="0.007") plot(skyline(ci, 0.0119),col=4);title(main="0.0119") plot(skyline(ci, 0.02));title(main="0.02") plot(skyline(ci, 0.05));title(main="0.05") plot(skyline(ci, 0.1));title(main="0.1") layout(1)# get tree data("hivtree.newick") # example tree in NH format tree.hiv <- read.tree(text = hivtree.newick) # load tree #### classic skyline plot skylineplot(tree.hiv) # shortcut #### plot classic and generalized skyline plots and estimate epsilon sk.opt <- skylineplot.deluxe(tree.hiv) sk.opt$epsilon #### classic and generalized skyline plot #### sk1 <- skyline(tree.hiv) sk2 <- skyline(tree.hiv, 0.0119) # use years rather than substitutions as unit for the time axis plot(sk1, show.years=TRUE, subst.rate=0.0023, present.year = 1997, col=c(grey(.8),1)) lines(sk2, show.years=TRUE, subst.rate=0.0023, present.year = 1997) legend(.15,500, c("classic", "generalized"), col=c(grey(.8),1),lty=1) #### various skyline plots for different epsilons layout(matrix(1:6, 2, 3, TRUE)) ci <- coalescent.intervals(tree.hiv) plot(skyline(ci, 0.0));title(main="0.0") plot(skyline(ci, 0.007));title(main="0.007") plot(skyline(ci, 0.0119),col=4);title(main="0.0119") plot(skyline(ci, 0.02));title(main="0.02") plot(skyline(ci, 0.05));title(main="0.05") plot(skyline(ci, 0.1));title(main="0.1") layout(1)
This function performs the Slowinski–Guyer test that a trait or variable does not increase diversification rate.
slowinskiguyer.test(x, detail = FALSE)slowinskiguyer.test(x, detail = FALSE)
x |
a matrix or a data frame with at least two columns: the first one gives the number of species in clades with a trait supposed to increase diversification rate, and the second one the number of species in the corresponding sister-clade without the trait. Each row represents a pair of sister-clades. |
detail |
if |
The Slowinski–Guyer test compares a series of sister-clades where one of the two is characterized by a trait supposed to increase diversification rate. The null hypothesis is that the trait does not affect diversification. If the trait decreased diversification rate, then the null hypothesis cannot be rejected.
The present function has mainly a historical interest. The Slowinski–Guyer test generally performs poorly: see Paradis (2012) alternatives and the functions cited below.
a data frame with the , the number of degrees of
freedom, and the P-value. If detail = TRUE, a list is
returned with the data frame and a vector of individual
P-values for each pair of sister-clades.
Emmanuel Paradis
Paradis, E. (2012) Shift in diversification in sister-clade comparisons: a more powerful test. Evolution, 66, 288–295.
Slowinski, J. B. and Guyer, C. (1993) Testing whether certain traits have caused amplified diversification: an improved method based on a model of random speciation and extinction. American Naturalist, 142, 1019–1024.
balance, mcconwaysims.test,
diversity.contrast.test,
richness.yule.test,
rc in geiger, shift.test in apTreeshape
### from Table 1 in Slowinski and Guyer(1993): viviparous <- c(98, 8, 193, 36, 7, 128, 2, 3, 23, 70) oviparous <- c(234, 17, 100, 4, 1, 12, 6, 1, 481, 11) x <- data.frame(viviparous, oviparous) slowinskiguyer.test(x, TRUE) # 'P ~ 0.32' in the paper xalt <- x xalt[3, 2] <- 1 slowinskiguyer.test(xalt)### from Table 1 in Slowinski and Guyer(1993): viviparous <- c(98, 8, 193, 36, 7, 128, 2, 3, 23, 70) oviparous <- c(234, 17, 100, 4, 1, 12, 6, 1, 481, 11) x <- data.frame(viviparous, oviparous) slowinskiguyer.test(x, TRUE) # 'P ~ 0.32' in the paper xalt <- x xalt[3, 2] <- 1 slowinskiguyer.test(xalt)
Replaces ambiguous bases in DNA sequences (R, Y, W, ...) by A, G, C, or T.
solveAmbiguousBases(x, method = "columnwise", random = TRUE)solveAmbiguousBases(x, method = "columnwise", random = TRUE)
x |
a matrix of class |
method |
the method used (no other choice than the default for the moment; see details). |
random |
a logical value (see details). |
The replacements of ambiguous bases are done columwise. First, the
base frequencies are counted: if no ambiguous base is found in the
column, nothing is done. By default (i.e., if random = TRUE),
the replacements are done by random sampling using the frequencies of
the observed compatible, non-ambiguous bases. For instance, if the
ambiguous base is Y, it is replaced by either C or T using their
observed frequencies as probabilities. If random = FALSE, the
greatest of these frequencies is used. If there are no compatible
bases in the column, equal probabilities are used. For instance, if
the ambiguous base is R, and only C and T are observed, then it is
replaced by either A or G with equal probabilities.
Alignment gaps are not changed; see the function latag2n
to change the leading and trailing gaps.
a matrix of class "DNAbin".
Emmanuel Paradis
X <- as.DNAbin(matrix(c("A", "G", "G", "R"), ncol = 1)) alview(solveAmbiguousBases(X)) # R replaced by either A or G alview(solveAmbiguousBases(X, random = FALSE)) # R always replaced by GX <- as.DNAbin(matrix(c("A", "G", "G", "R"), ncol = 1)) alview(solveAmbiguousBases(X)) # R replaced by either A or G alview(solveAmbiguousBases(X, random = FALSE)) # R always replaced by G
This function calculates the species tree from a set of gene trees.
speciesTree(x, FUN = min)speciesTree(x, FUN = min)
x |
a list of trees, e.g., an object of class
|
FUN |
a function used to compute the divergence times of each pair of tips. |
For all trees in x, the divergence time of each pair of tips is
calculated: these are then ‘summarized’ with FUN to build a new
distance matrix used to calculate the species tree with a
single-linkage hierarchical clustering. The default for FUN
computes the maximum tree (maxtree) of Liu et al. (2010). Using
FUN = mean gives the shallowest divergence tree of Maddison and
Knowles (2006).
an object of class "phylo".
Emmanuel Paradis
Liu, L., Yu, L. and Pearl, D. K. (2010) Maximum tree: a consistent estimator of the species tree. Journal of Mathematical Biology, 60, 95–106.
Maddison, W. P. and Knowles, L. L. (2006) Inferring phylogeny despite incomplete lineage sorting. Systematic Biology, 55, 21–30.
### example in Liu et al. (2010): tr1 <- read.tree(text = "(((B:0.05,C:0.05):0.01,D:0.06):0.04,A:0.1);") tr2 <- read.tree(text = "(((A:0.07,C:0.07):0.02,D:0.09):0.03,B:0.12);") TR <- c(tr1, tr2) TSmax <- speciesTree(TR) # MAXTREE TSsha <- speciesTree(TR, mean) # shallowest divergence kronoviz(c(tr1, tr2, TSmax, TSsha), horiz = FALSE, type = "c", cex = 1.5, font = 1) mtext(c("Gene tree 1", "Gene tree 2", "Species tree - MAXTREE"), at = -c(7.5, 4, 1)) mtext("Species tree - Shallowest Divergence") layout(1)### example in Liu et al. (2010): tr1 <- read.tree(text = "(((B:0.05,C:0.05):0.01,D:0.06):0.04,A:0.1);") tr2 <- read.tree(text = "(((A:0.07,C:0.07):0.02,D:0.09):0.03,B:0.12);") TR <- c(tr1, tr2) TSmax <- speciesTree(TR) # MAXTREE TSsha <- speciesTree(TR, mean) # shallowest divergence kronoviz(c(tr1, tr2, TSmax, TSsha), horiz = FALSE, type = "c", cex = 1.5, font = 1) mtext(c("Gene tree 1", "Gene tree 2", "Species tree - MAXTREE"), at = -c(7.5, 4, 1)) mtext("Species tree - Shallowest Divergence") layout(1)
This function generates trees with regular shapes.
stree(n, type = "star", tip.label = NULL)stree(n, type = "star", tip.label = NULL)
n |
an integer giving the number of tips in the tree. |
type |
a character string specifying the type of tree to
generate; four choices are possible: |
tip.label |
a character vector giving the tip labels; if not specified, the tips "t1", "t2", ..., are given. |
The types of trees generated are:
“star”: a star (or comb) tree with a single internal node.
“balanced”: a fully balanced dichotomous rooted tree;
n must be a power of 2 (2, 4, 8, ...).
“left”: a fully unbalanced rooted tree where the largest clade is on the left-hand side when the tree is plotted upwards.
“right”: same than above but in the other direction.
An object of class "phylo".
Emmanuel Paradis
layout(matrix(1:4, 2, 2)) plot(stree(100)) plot(stree(128, "balanced")) plot(stree(100, "left")) plot(stree(100, "right")) layout(1)layout(matrix(1:4, 2, 2)) plot(stree(100)) plot(stree(128, "balanced")) plot(stree(100, "left")) plot(stree(100, "right")) layout(1)
This function plots simultaneously a whole phylogenetic tree (supposedly large) and a portion of it determined by clicking on the nodes of the phylogeny. On exit, returns the last subtree visualized.
subtreeplot(x, wait=FALSE, ...)subtreeplot(x, wait=FALSE, ...)
x |
an object of class |
wait |
a logical indicating whether the node beeing processed should be printed (useful for big phylogenies). |
... |
further arguments passed to |
This function aims at easily exploring very large trees. The main argument is a phylogenetic tree, and the second one is a logical indicating whether a waiting message should be printed while the calculation is being processed.
The whole tree is plotted on the left-hand side in half of the device. The subtree is plotted on the right-hand side in the other half. The user clicks on the nodes in the complete tree and the subtree corresponding to this node is ploted in the right-hand side. There is no limit for the number of clicks that can be done. On exit, the subtree on the right hand side is returned.
To use a subtree as the new tree in which to zoom, the user has to use the function many times. This can however be done in a single command line (see example 2).
Damien de Vienne [email protected]
plot.phylo, drop.tip, subtrees
## Not run: #example 1: simple tree1 <- rtree(50) tree2 <- subtreeplot(tree1, wait = TRUE) # on exit, tree2 will be a subtree of tree1 #example 2: more than one zoom tree1 <- rtree(60) tree2 <- subtreeplot(subtreeplot(subtreeplot(tree1))) # allow three succssive zooms ## End(Not run)## Not run: #example 1: simple tree1 <- rtree(50) tree2 <- subtreeplot(tree1, wait = TRUE) # on exit, tree2 will be a subtree of tree1 #example 2: more than one zoom tree1 <- rtree(60) tree2 <- subtreeplot(subtreeplot(subtreeplot(tree1))) # allow three succssive zooms ## End(Not run)
This function returns a list of all the subtrees of a phylogenetic tree.
subtrees(tree, wait=FALSE)subtrees(tree, wait=FALSE)
tree |
an object of class |
wait |
a logical indicating whether the node beeing processed should be printed (useful for big phylogenies). |
subtrees returns a list of trees of class "phylo" and
returns invisibly for each subtree a list with the following
components:
tip.label |
|
node.label |
|
Ntip |
|
Nnode |
Damien de Vienne [email protected]
zoom, subtreeplot for functions extracting particular subtrees.
### Random tree with 12 leaves phy<-rtree(12) par(mfrow=c(4,3)) plot(phy, sub="Complete tree") ### Extract the subtrees l<-subtrees(phy) ### plot all the subtrees for (i in 1:11) plot(l[[i]], sub=paste("Node", l[[i]]$node.label[1])) par(mfrow=c(1,1))### Random tree with 12 leaves phy<-rtree(12) par(mfrow=c(4,3)) plot(phy, sub="Complete tree") ### Extract the subtrees l<-subtrees(phy) ### plot all the subtrees for (i in 1:11) plot(l[[i]], sub=paste("Node", l[[i]]$node.label[1])) par(mfrow=c(1,1))
The first function prints a compact summary of a phylogenetic tree (an
object of class "phylo"). The three other functions return the
number of tips, nodes, or edges, respectively.
## S3 method for class 'phylo' summary(object, ...) Ntip(phy) ## S3 method for class 'phylo' Ntip(phy) ## S3 method for class 'multiPhylo' Ntip(phy) Nnode(phy, ...) ## S3 method for class 'phylo' Nnode(phy, internal.only = TRUE, ...) ## S3 method for class 'multiPhylo' Nnode(phy, internal.only = TRUE, ...) Nedge(phy) ## S3 method for class 'phylo' Nedge(phy) ## S3 method for class 'multiPhylo' Nedge(phy)## S3 method for class 'phylo' summary(object, ...) Ntip(phy) ## S3 method for class 'phylo' Ntip(phy) ## S3 method for class 'multiPhylo' Ntip(phy) Nnode(phy, ...) ## S3 method for class 'phylo' Nnode(phy, internal.only = TRUE, ...) ## S3 method for class 'multiPhylo' Nnode(phy, internal.only = TRUE, ...) Nedge(phy) ## S3 method for class 'phylo' Nedge(phy) ## S3 method for class 'multiPhylo' Nedge(phy)
object, phy
|
an object of class |
... |
further arguments passed to or from other methods. |
internal.only |
a logical indicating whether to return the number
of internal nodes only (the default), or of internal and terminal
(tips) nodes (if |
The summary includes the numbers of tips and of nodes, summary statistics of the branch lengths (if they are available) with mean, variance, minimum, first quartile, median, third quartile, and maximum, listing of the first ten tip labels, and (if available) of the first ten node labels. It is also printed whether some of these optional elements (branch lengths, node labels, and root edge) are not found in the tree.
summary simply prints its results on the standard output and is
not meant for programming.
A NULL value in the case of summary, a single numeric value for
the three other functions.
Emmanuel Paradis
read.tree, summary for the generic R
function, multiphylo, c.phylo
data(bird.families) summary(bird.families) Ntip(bird.families) Nnode(bird.families) Nedge(bird.families)data(bird.families) summary(bird.families) Ntip(bird.families) Nnode(bird.families) Nedge(bird.families)
trans translates DNA sequences into amino acids.
complement returns the (reverse) complement sequences.
trans(x, code = 1, codonstart = 1) complement(x)trans(x, code = 1, codonstart = 1) complement(x)
x |
an object of class |
code |
an integer value giving the genetic code to be used. Currently only the genetic codes 1 to 6 are supported. |
codonstart |
an integer giving where to start the translation. This should be 1, 2, or 3, but larger values are accepted and have for effect to start the translation further towards the 3'-end of the sequence. |
With trans, if the sequence length is not a multiple of three,
a warning message is printed. Alignment gaps are simply ignored (i.e.,
AG- returns X with no special warning or message). Base
ambiguities are taken into account where relevant: for instance,
GGN, GGA, GGR, etc, all return G.
See the link given in the References for details about the taxonomic coverage and alternative codons of each code.
an object of class "AAbin" or "DNAbin", respectively.
These functions are equivalent to translate and comp in
the package seqinr with the difference that there is no need to
convert the sequences into character strings.
Emmanuel Paradis
https://www.ncbi.nlm.nih.gov/Taxonomy/taxonomyhome.html/index.cgi?chapter=cgencodes
data(woodmouse) X <- trans(woodmouse) # not correct X2 <- trans(woodmouse, 2) # using the correct code identical(X, X2) alview(X[1:2, 1:60]) # some 'Stop' codons (*) alview(X2[, 1:60]) X2data(woodmouse) X <- trans(woodmouse) # not correct X2 <- trans(woodmouse, 2) # using the correct code identical(X, X2) alview(X[1:2, 1:60]) # some 'Stop' codons (*) alview(X2[, 1:60]) X2
Method for reconstructing phylogenetic trees from an object of class splits using tree popping.
treePop(obj)treePop(obj)
obj |
an object of class |
an object of class "phylo" which displays all the splits in the input object.
Andrei Popescu
This function requires a plotted tree: the user is invited to click close to a node and the corresponding subtree (or clade) is plotted on a new window.
trex(phy, title = TRUE, subbg = "lightyellow3", return.tree = FALSE, ...)trex(phy, title = TRUE, subbg = "lightyellow3", return.tree = FALSE, ...)
phy |
an object of class |
title |
a logical or a character string (see details). |
subbg |
a character string giving the background colour for the subtree. |
return.tree |
a logical: if |
... |
further arguments to pass to |
This function works with a tree (freshly) plotted on an interactive
graphical device (i.e., not a file). After calling trex, the
user clicks close to a node of the tree, then the clade from this node
is plotted on a new window. The user can click as many times on
the main tree: the clades are plotted successively on the same
new window. The process is stopped by a right-click. If the user clicks
too close to the tips, a message “Try again!” is printed.
Each time trex is called, the subtree is plotted on a new
window without closing or deleting those possibly already
plotted. They may be distinguished with the options title
and/or subbg.
In all cases, the device where phy is plotted is the active
window after the operation. It should not be closed during the
whole process.
If title = TRUE, a default title is printed on the new window
using the node label, or the node number if there are no node labels
in the tree. If title = FALSE, no title is printed. If
title is a character string, it is used for the title.
an object of class "phylo" if return.tree = TRUE
Emmanuel Paradis
## Not run: tr <- rcoal(1000) plot(tr, show.tip.label = FALSE) trex(tr) # left-click as many times as you want, then right-click tr <- makeNodeLabel(tr) trex(tr, subbg = "lightgreen") # id. ## generate a random colour with control on the darkness: rRGB <- function(a, b) rgb(runif(1, a, b), runif(1, a, b), runif(1, a, b)) ### with a random pale background: trex(tr, subbg = rRGB(0.8, 1)) ## the above can be called many times... graphics.off() # close all graphical devices ## End(Not run)## Not run: tr <- rcoal(1000) plot(tr, show.tip.label = FALSE) trex(tr) # left-click as many times as you want, then right-click tr <- makeNodeLabel(tr) trex(tr, subbg = "lightgreen") # id. ## generate a random colour with control on the darkness: rRGB <- function(a, b) rgb(runif(1, a, b), runif(1, a, b), runif(1, a, b)) ### with a random pale background: trex(tr, subbg = rRGB(0.8, 1)) ## the above can be called many times... graphics.off() # close all graphical devices ## End(Not run)
Fast distance-based construction method. Should only be used when distance measures are fairly reliable.
triangMtd(X) triangMtds(X)triangMtd(X) triangMtds(X)
X |
a distance matrix |
.
an object of class "phylo".
Andrei Popescu
http://archive.numdam.org/ARCHIVE/RO/RO_2001__35_2/RO_2001__35_2_283_0/RO_2001__35_2_283_0.pdf
nj, bionj, fastme,
njs, mvrs, SDM
data(woodmouse) tr <- triangMtd(dist.dna(woodmouse)) plot(tr)data(woodmouse) tr <- triangMtd(dist.dna(woodmouse)) plot(tr)
This function scans a list of trees, and returns a list with the duplicate trees removed. By default the labelled topologies are compared.
## S3 method for class 'multiPhylo' unique(x, incomparables = FALSE, use.edge.length = FALSE, use.tip.label = TRUE, ...)## S3 method for class 'multiPhylo' unique(x, incomparables = FALSE, use.edge.length = FALSE, use.tip.label = TRUE, ...)
x |
an object of class |
incomparables |
unused (for compatibility with the generic). |
use.edge.length |
a logical specifying whether to consider the edge
lengths in the comparisons; the default is |
use.tip.label |
a logical specifying whether to consider the tip
labels in the comparisons; the default is |
... |
further arguments passed to or from other methods. |
an object of class "multiPhylo" with an attribute
"old.index" indicating which trees of the original list are
similar (the tree of smaller index is taken as reference).
Emmanuel Paradis
all.equal.phylo, unique for the generic R
function, read.tree, read.nexus
TR <- rmtree(50, 4) length(unique(TR)) # not always 15... howmanytrees(4)TR <- rmtree(50, 4) length(unique(TR)) # not always 15... howmanytrees(4)
This function changes labels (names or rownames) giving two vectors (old and new). It is a generic function with several methods as described below.
updateLabel(x, old, new, ...) ## S3 method for class 'character' updateLabel(x, old, new, exact = TRUE, ...) ## S3 method for class 'DNAbin' updateLabel(x, old, new, exact = TRUE, ...) ## S3 method for class 'AAbin' updateLabel(x, old, new, exact = TRUE, ...) ## S3 method for class 'phylo' updateLabel(x, old, new, exact = TRUE, nodes = FALSE, ...) ## S3 method for class 'evonet' updateLabel(x, old, new, exact = TRUE, nodes = FALSE, ...) ## S3 method for class 'data.frame' updateLabel(x, old, new, exact = TRUE, ...) ## S3 method for class 'matrix' updateLabel(x, old, new, exact = TRUE, ...)updateLabel(x, old, new, ...) ## S3 method for class 'character' updateLabel(x, old, new, exact = TRUE, ...) ## S3 method for class 'DNAbin' updateLabel(x, old, new, exact = TRUE, ...) ## S3 method for class 'AAbin' updateLabel(x, old, new, exact = TRUE, ...) ## S3 method for class 'phylo' updateLabel(x, old, new, exact = TRUE, nodes = FALSE, ...) ## S3 method for class 'evonet' updateLabel(x, old, new, exact = TRUE, nodes = FALSE, ...) ## S3 method for class 'data.frame' updateLabel(x, old, new, exact = TRUE, ...) ## S3 method for class 'matrix' updateLabel(x, old, new, exact = TRUE, ...)
x |
an object where to change the labels. |
old, new
|
two vectors of mode character (must be of the same length). |
exact |
a logical value (see details). |
nodes |
a logical value specifying whether to also update the node labels of the tree or network. |
... |
further arguments passed to and from methods. |
This function can be used to change some of the labels (see examples) or all of them if their ordering is not sure.
If exact = TRUE (the default), the values in old are matched exactly with the labels; otherwise (exact = FALSE), the values in old are considered as regular expressions and searched in the labels with grep.
an object of the same class than x.
Emmanuel Paradis
makeLabel, makeNodeLabel,
mixedFontLabel, stripLabel,
checkLabel
## Not run: ## the tree by Nyakatura & Bininda-Emonds (2012, BMC Biology) x <- "https://static-content.springer.com/esm/art" y <- "3A10.1186" z <- "2F1741-7007-10-12/MediaObjects/12915_2011_534_MOESM5_ESM.NEX" ## The commande below may not print correctly in HTML because of the ## percentage symbol; see the text or PDF help page. url <- paste(x, y, z, sep = " TC <- read.nexus(url) tr <- TC$carnivoreST_bestEstimate old <- c("Uncia_uncia", "Felis_manul", "Leopardus_jacobitus") new <- c("Panthera_uncia", "Otocolobus_manul", "Leopardus_jacobita") tr.updated <- updateLabel(tr, old, new) ## End(Not run) tr <- rtree(6) ## the order of the labels are randomized by this function old <- paste0("t", 1:6) new <- paste0("x", 1:6) updateLabel(tr, old, new) tr## Not run: ## the tree by Nyakatura & Bininda-Emonds (2012, BMC Biology) x <- "https://static-content.springer.com/esm/art" y <- "3A10.1186" z <- "2F1741-7007-10-12/MediaObjects/12915_2011_534_MOESM5_ESM.NEX" ## The commande below may not print correctly in HTML because of the ## percentage symbol; see the text or PDF help page. url <- paste(x, y, z, sep = " TC <- read.nexus(url) tr <- TC$carnivoreST_bestEstimate old <- c("Uncia_uncia", "Felis_manul", "Leopardus_jacobitus") new <- c("Panthera_uncia", "Otocolobus_manul", "Leopardus_jacobita") tr.updated <- updateLabel(tr, old, new) ## End(Not run) tr <- rtree(6) ## the order of the labels are randomized by this function old <- paste0("t", 1:6) new <- paste0("x", 1:6) updateLabel(tr, old, new) tr
Get variance component estimates from a fitted lme object.
varcomp(x, scale = FALSE, cum = FALSE)varcomp(x, scale = FALSE, cum = FALSE)
x |
A fitted |
scale |
Scale all variance so that they sum to 1 |
cum |
Send cumulative variance components. |
Variance computations is done as in Venables and Ripley (2002).
A named vector of class varcomp with estimated variance components.
Julien Dutheil [email protected]
Venables, W. N. and Ripley, B. D. (2002) Modern Applied Statistics with S (Fourth Edition). New York: Springer-Verlag.
data(carnivora) library(nlme) m <- lme(log10(SW) ~ 1, random = ~ 1|Order/SuperFamily/Family/Genus, data=carnivora) v <- varcomp(m, TRUE, TRUE) plot(v)data(carnivora) library(nlme) m <- lme(log10(SW) ~ 1, random = ~ 1|Order/SuperFamily/Family/Genus, data=carnivora) v <- varcomp(m, TRUE, TRUE) plot(v)
This function calls Phylip's contrast program and returns the phylogenetic and phenotypic variance-covariance components for one or several traits. There can be several observations per species.
varCompPhylip(x, phy, exec = NULL)varCompPhylip(x, phy, exec = NULL)
x |
a numeric vector, a matrix (or data frame), or a list. |
phy |
an object of class |
exec |
a character string giving the name of the executable contrast program (see details). |
The data x can be in several forms: (i) a numeric vector if
there is single trait and one observation per species; (ii) a
matrix or data frame if there are several traits (as columns) and a
single observation of each trait for each species; (iii) a list of
vectors if there is a single trait and several observations per
species; (iv) a list of matrices or data frames: same than (ii) but
with several traits and the rows are individuals.
If x has names, its values are matched to the tip labels of
phy, otherwise its values are taken to be in the same order
than the tip labels of phy.
Phylip (version 3.68 or higher) must be accessible on your computer. If
you have a Unix-like operating system, the executable name is assumed
to be "phylip contrast" (as in Debian); otherwise it is set
to "contrast". If this doesn't suit your system, use the
option exec accordingly. If the executable is not in the path, you
may need to specify it, e.g., exec = "C:/Program Files/Phylip/contrast".
a list with elements varA and varE with the phylogenetic
(additive) and phenotypic (environmental) variance-covariance
matrices. If a single trait is analyzed, these contains its variances.
Emmanuel Paradis
Felsenstein, J. (2004) Phylip (Phylogeny Inference Package) version 3.68. Department of Genetics, University of Washington, Seattle, USA. http://evolution.genetics.washington.edu/phylip/phylip.html.
Felsenstein, J. (2008) Comparative methods with sampling error and within-species variation: Contrasts revisited and revised. American Naturalist, 171, 713–725.
## Not run: tr <- rcoal(30) ### Five traits, one observation per species: x <- replicate(5, rTraitCont(tr, sigma = 1)) varCompPhylip(x, tr) # varE is small x <- replicate(5, rnorm(30)) varCompPhylip(x, tr) # varE is large ### Five traits, ten observations per species: x <- replicate(30, replicate(5, rnorm(10)), simplify = FALSE) varCompPhylip(x, tr) ## End(Not run)## Not run: tr <- rcoal(30) ### Five traits, one observation per species: x <- replicate(5, rTraitCont(tr, sigma = 1)) varCompPhylip(x, tr) # varE is small x <- replicate(5, rnorm(30)) varCompPhylip(x, tr) # varE is large ### Five traits, ten observations per species: x <- replicate(30, replicate(5, rnorm(10)), simplify = FALSE) varCompPhylip(x, tr) ## End(Not run)
This function computes the expected variances and covariances of a continuous trait assuming it evolves under a given model.
This is a generic function with methods for objects of class
"phylo" and "corPhyl".
vcv(phy, ...) ## S3 method for class 'phylo' vcv(phy, model = "Brownian", corr = FALSE, ...) ## S3 method for class 'corPhyl' vcv(phy, corr = FALSE, ...)vcv(phy, ...) ## S3 method for class 'phylo' vcv(phy, model = "Brownian", corr = FALSE, ...) ## S3 method for class 'corPhyl' vcv(phy, corr = FALSE, ...)
phy |
an object of the correct class (see above). |
model |
a character giving the model used to compute the
variances and covariances; only |
corr |
a logical indicating whether the correlation matrix should
be returned ( |
... |
further arguments to be passed to or from other methods. |
a numeric matrix with the names of the tips as colnames and rownames.
Do not confuse this function with vcov which
computes the variance-covariance matrix among parameters of a fitted
model object.
Emmanuel Paradis
Garland, T. Jr. and Ives, A. R. (2000) Using the past to predict the present: confidence intervals for regression equations in phylogenetic comparative methods. American Naturalist, 155, 346–364.
corBrownian, corMartins,
corGrafen, corPagel,
corBlomberg, vcv2phylo
tr <- rtree(5) ## all are the same: vcv(tr) vcv(corBrownian(1, tr)) vcv(corPagel(1, tr))tr <- rtree(5) ## all are the same: vcv(tr) vcv(corBrownian(1, tr)) vcv(corPagel(1, tr))
This function transforms a variance-covariance matrix into a phylogenetic tree.
vcv2phylo(mat, tolerance = 1e-7)vcv2phylo(mat, tolerance = 1e-7)
mat |
a square symmetric (positive-definite) matrix. |
tolerance |
the numeric tolerance used to compare the branch lengths. |
The function tests if the matrix is symmetric and positive-definite (i.e., all its eigenvalues positive within the specified tolerance).
an object of class "phylo".
Simon Blomberg
tr <- rtree(10) V <- vcv(tr) # VCV matrix assuming Brownian motion z <- vcv2phylo(V) identical(tr, z) # FALSE all.equal(tr, z) # TRUEtr <- rtree(10) V <- vcv(tr) # VCV matrix assuming Brownian motion z <- vcv2phylo(V) identical(tr, z) # FALSE all.equal(tr, z) # TRUE
weight.taxo computes a matrix whose entries [i, j] are set to 1
if x[i] == x[j], 0 otherwise.
weight.taxo2 computes a matrix whose entries [i, j] are set to 1
if x[i] == x[j] AND y[i] != y[j], 0 otherwise.
The diagonal [i, i] is always set to 0.
The returned matrix can be used as a weight matrix in
Moran.I. x and y may be vectors of
factors.
See further details in vignette("MoranI").
weight.taxo(x) weight.taxo2(x, y)weight.taxo(x) weight.taxo2(x, y)
x, y
|
a vector or a factor. |
a square numeric matrix.
Emmanuel Paradis
This function finds patterns in a single or a set of DNA or AA sequences.
where(x, pattern)where(x, pattern)
x |
an object inheriting the class either |
pattern |
a character string to be searched in |
If x is a vector, the function returns a single vector giving
the position(s) where the pattern was found. If x is a matrix
or a list, it returns a list with the positions of the pattern for
each sequence.
Patterns may be overlapping. For instance, if pattern = "tata"
and the sequence starts with ‘tatata’, then the output will be c(1, 3).
a vector of integers or a list of such vectors.
Emmanuel Paradis
data(woodmouse) where(woodmouse, "tata") ## with AA sequences: x <- trans(woodmouse, 2) where(x, "irk")data(woodmouse) where(woodmouse, "tata") ## with AA sequences: x <- trans(woodmouse, 2) where(x, "irk")
This function identifies the edges that belong to a group (possibly non-monophyletic) specified as a set of tips.
which.edge(phy, group)which.edge(phy, group)
phy |
an object of class |
group |
a vector of mode numeric or character specifying the tips for which the edges are to be identified. |
The group of tips specified in ‘group’ may be non-monophyletic (paraphyletic or polyphyletic), in which case all edges from the tips to their most recent common ancestor are identified.
The identification is made with the indices of the rows of the matrix ‘edge’ of the tree.
a numeric vector.
Emmanuel Paradis
This is a set of 15 sequences of the mitochondrial gene cytochrome b of the woodmouse (Apodemus sylvaticus) which is a subset of the data analysed by Michaux et al. (2003). The full data set is available through GenBank (accession numbers AJ511877 to AJ511987).
data(woodmouse)data(woodmouse)
An object of class "DNAbin".
Michaux, J. R., Magnanou, E., Paradis, E., Nieberding, C. and Libois, R. (2003) Mitochondrial phylogeography of the Woodmouse (Apodemus sylvaticus) in the Western Palearctic region. Molecular Ecology, 12, 685–697.
data(woodmouse) str(woodmouse)data(woodmouse) str(woodmouse)
These functions write in a file a list of DNA sequences in sequential,
interleaved, or FASTA format. write.FASTA can write either DNA
or AA sequences.
write.dna(x, file, format = "interleaved", append = FALSE, nbcol = 6, colsep = " ", colw = 10, indent = NULL, blocksep = 1) write.FASTA(x, file, header = NULL, append = FALSE)write.dna(x, file, format = "interleaved", append = FALSE, nbcol = 6, colsep = " ", colw = 10, indent = NULL, blocksep = 1) write.FASTA(x, file, header = NULL, append = FALSE)
x |
a list or a matrix of DNA sequences, or of AA sequences for
|
file |
a file name specified by either a variable of mode character, or a double-quoted string. |
format |
a character string specifying the format of the DNA
sequences. Three choices are possible: |
append |
a logical, if |
nbcol |
a numeric specifying the number of columns per row (6 by default); may be negative implying that the nucleotides are printed on a single line. |
colsep |
a character used to separate the columns (a single space by default). |
colw |
a numeric specifying the number of nucleotides per column (10 by default). |
indent |
a numeric or a character specifying how the blocks of nucleotides are indented (see details). |
blocksep |
a numeric specifying the number of lines between the blocks of nucleotides (this has an effect only if 'format = "interleaved"'). |
header |
a vector of mode character giving the header to be written in the FASTA file before the sequences. By default, there is no header. |
Three formats are supported in the present function: see the help page
of read.dna and the references below for a description.
If the sequences have no names, then they are given "1", "2", ... as labels in the file.
With the interleaved and sequential formats, the sequences must be all of the same length. The names of the sequences are not truncated.
The argument indent specifies how the rows of nucleotides are
indented. In the interleaved and sequential formats, the rows with
the taxon names are never indented; the subsequent rows are indented
with 10 spaces by default (i.e., if indent = NULL). In the FASTA
format, the rows are not indented by default. This default behaviour
can be modified by specifying a value to indent: the rows are then
indented with “indent” (if it is a character) or ‘indent’ spaces (if
it is a numeric). For example, specifying indent = " " or
indent = 3 will have the same effect (use indent = "\t"
for a tabulation).
The different options are intended to give flexibility in formatting the sequences. For instance, if the sequences are very long it may be judicious to remove all the spaces beween columns (colsep = ""), in the margins (indent = 0), and between the blocks (blocksep = 0) to produce a smaller file.
write.dna(, format = "fasta") can be very slow if the sequences
are long (> 10 kb). write.FASTA is much faster in this
situation but the formatting is not flexible: each sequence is printed
on a single line, which is OK for big files that are not intended to
be open with a text editor.
None (invisible ‘NULL’).
Specifying a negative value for ‘nbcol’ (meaning that the nucleotides are printed on a single line) gives the same output for the interleaved and sequential formats.
The names of the sequences can be truncated with the function
makeLabel. In particular, Clustal is limited to 30
characters, and PHYML seems limited to 99 characters.
Emmanuel Paradis
Anonymous. FASTA format. https://en.wikipedia.org/wiki/FASTA_format
Felsenstein, J. (1993) Phylip (Phylogeny Inference Package) version 3.5c. Department of Genetics, University of Washington. http://evolution.genetics.washington.edu/phylip/phylip.html
read.dna, read.GenBank,
makeLabel
This function writes trees in a file with the NEXUS format.
write.nexus(..., file = "", translate = TRUE, digits = 10)write.nexus(..., file = "", translate = TRUE, digits = 10)
... |
either (i) a single object of class |
file |
a file name specified by either a variable of mode character,
or a double-quoted string; if |
translate |
a logical, if |
digits |
a numeric giving the number of digits used for printing branch lengths. For negative numbers no branch lengths are printed. |
If several trees are given, they must all have the same tip labels.
If among the objects given some are not trees of class "phylo",
they are simply skipped and not written in the file.
See write.tree for details on how tip (and node) labels
are checked before being printed.
None (invisible ‘NULL’).
Emmanuel Paradis
Maddison, D. R., Swofford, D. L. and Maddison, W. P. (1997) NEXUS: an extensible file format for systematic information. Systematic Biology, 46, 590–621.
read.nexus, read.tree,
write.tree, read.nexus.data,
write.nexus.data, write.phyloXML
This function writes in a file a list of data in the NEXUS format. The names of the vectors of the list are used as taxon names.
For the moment, only sequence data (DNA or protein) are supported.
write.nexus.data(x, file, format = "dna", datablock = TRUE, interleaved = TRUE, charsperline = 80, gap = "-", missing = "?")write.nexus.data(x, file, format = "dna", datablock = TRUE, interleaved = TRUE, charsperline = 80, gap = "-", missing = "?")
x |
a matrix or a list of data each made of a single vector of mode character where each element is a character state (e.g., “A”, “C”, ...) Objects of class of “DNAbin” are accepted. |
file |
a file name specified by either a variable of mode character, or a double-quoted string. |
format |
a character string specifying the format of the
sequences. Four choices are possible: |
datablock |
a logical, if |
interleaved |
a logical, if |
charsperline |
a numeric value specifying the number of
characters per line when used with |
gap |
a character specifying the symbol for gap. |
missing |
a character specifying the symbol for missing data. |
If the sequences have no names, then they are given “1”, “2”, ..., as names in the file.
Sequences must be all of the same length.
None (invisible ‘NULL’).
Johan Nylander [email protected] and Thomas Guillerme
Maddison, D. R., Swofford, D. L. and Maddison, W. P. (1997) NEXUS: an extensible file format for systematic information. Systematic Biology, 46, 590–621.
read.nexus, write.nexus,
read.nexus.data
## Not run: ## Write interleaved DNA data with 100 characters per line in a DATA block data(woodmouse) write.nexus.data(woodmouse, file = "wood_dna.nex", interleaved = TRUE, charsperline = 100) ## Write sequential DNA data in TAXA and CHARACTERS blocks wood_aa <- trans(woodmouse, 2) write.nexus.data(wood_aa, file = "wood_aa.nex", format = "protein", datablock = FALSE, interleaved = FALSE) unlink(c("wood_dna.nex", "wood_aa.nex")) ## End(Not run)## Not run: ## Write interleaved DNA data with 100 characters per line in a DATA block data(woodmouse) write.nexus.data(woodmouse, file = "wood_dna.nex", interleaved = TRUE, charsperline = 100) ## Write sequential DNA data in TAXA and CHARACTERS blocks wood_aa <- trans(woodmouse, 2) write.nexus.data(wood_aa, file = "wood_aa.nex", format = "protein", datablock = FALSE, interleaved = FALSE) unlink(c("wood_dna.nex", "wood_aa.nex")) ## End(Not run)
This function writes trees to a file of phyloXML format.
write.phyloXML(phy, file = "", tree.names = FALSE)write.phyloXML(phy, file = "", tree.names = FALSE)
phy |
an object of class |
file |
a file name specified by either a variable of mode character,
or a double-quoted string; if |
tree.names |
either a logical or a vector of mode character specifying whether or which tree names should be written to the file. |
If several trees are given, they will be represented as multiple
<phylogeny> elements. Contrary to write.nexus, the trees
need not have the same tip labels.
When tree.names is TRUE, the tree names will be always
added as <name> tags to each phylogeny element. If the phy
object is unnamed, then the names will be automatically generated
from the tree indices as "tree<index>" (e.g. tree1, tree2, ...). If
tree.names is a character vector, the specified names will be
used instead.
Branch lengths, labels, and rootedness are preserved in the phyloXML file.
None (invisible NULL).
Federico Marotta
Han, M. V. and Zmasek, C. M. (2009) phyloXML: XML for evolutionary biology and comparative genomics. BMC Bioinformatics, 10, 356.
read.tree, write.tree,
read.nexus, write.nexus,
read.nexus.data, write.nexus.data
This function writes in a file a tree in parenthetic format using the Newick (also known as New Hampshire) format.
write.tree(phy, file = "", append = FALSE, digits = 10, tree.names = FALSE)write.tree(phy, file = "", append = FALSE, digits = 10, tree.names = FALSE)
phy |
an object of class |
file |
a file name specified by either a variable of mode character,
or a double-quoted string; if |
append |
a logical, if |
digits |
a numeric giving the number of (significant) digits used for printing branch lengths (see details). For negative numbers no branch lengths are printed. |
tree.names |
either a logical or a vector of mode character. If
|
The node labels and the root edge length, if available, are written in the file.
If tree.names == TRUE then a variant of the Newick format is
written for which the name of a tree precedes the Newick format tree
(parentheses are eventually deleted beforehand). The tree names are
taken from the names attribute if present (they are ignored if
tree.names is a character vector).
The tip labels (and the node labels if present) are checked before being printed: the leading and trailing spaces, and the leading left and trailing right parentheses are deleted; the other spaces are replaced by underscores; the commas, colons, semicolons, and the other parentheses are replaced with dashes.
The argument digits gives the number of significant
digits (not rounding). For instance, if digits = 2 the branch
length 1.234e-7 is printed as 1.23e-7 (not 0).
a vector of mode character if file = "", none (invisible
NULL) otherwise.
Emmanuel Paradis, Daniel Lawson [email protected], and Klaus Schliep [email protected]
Felsenstein, J. The Newick tree format. http://evolution.genetics.washington.edu/phylip/newicktree.html
Olsen, G. Interpretation of the "Newick's 8:45" tree format standard. http://evolution.genetics.washington.edu/phylip/newick_doc.html
read.tree, read.nexus,
write.nexus, write.phyloXML
These functions help to find files on the local disk.
Xplorefiles(from = "HOME", recursive = TRUE, ignore.case = TRUE) editFileExtensions() bydir(x) Xplor(from = "HOME")Xplorefiles(from = "HOME", recursive = TRUE, ignore.case = TRUE) editFileExtensions() bydir(x) Xplor(from = "HOME")
from |
the directory where to start the file search; by default,
the ‘HOME’ directory. Use |
recursive |
whether to search the subdirectories; |
ignore.case |
whether to ignore the case of the file extensions;
|
x |
a list returned by |
Xplorefiles looks for all files with a specified extension in
their names. The default is to look for the following file types:
CLUSTAL (.aln), FASTA (.fas, .fasta, .fna, .faa), FASTQ (.fq, .fastq),
NEWICK (.nwk, .newick, .tre, .tree), NEXUS (.nex, .nexus), and PHYLIP
(.phy). This list can be modified with editFileExtensions.
bydir sorts the list of files by directories.
Xplor combines these operations and opens the results in
a Web browser with clickable links to the directories and files.
Xplorefiles returns a list. bydir prints the file
listings on the console.
Emmanuel Paradis
## Not run: x <- Xplorefiles() x # all data files on your disk bydir(x) # sorted by directories bydir(x["fasta"]) # only the FASTA files Xplorefiles(getwd(), recursive = FALSE) # look only in current dir Xplor() ## End(Not run)## Not run: x <- Xplorefiles() x # all data files on your disk bydir(x) # sorted by directories bydir(x["fasta"]) # only the FASTA files Xplorefiles(getwd(), recursive = FALSE) # look only in current dir Xplor() ## End(Not run)
This function fits by maximum likelihood a Yule model, i.e., a birth-only model to the branching times computed from a phylogenetic tree.
yule(phy, use.root.edge = FALSE)yule(phy, use.root.edge = FALSE)
phy |
an object of class |
use.root.edge |
a logical specifying whether to consider the root edge in the calculations. |
The tree must be fully dichotomous.
The maximum likelihood estimate of the speciation rate is obtained by the ratio of the number of speciation events on the cumulative number of species through time; these two quantities are obtained with the number of nodes in the tree, and the sum of the branch lengths, respectively.
If there is a ‘root.edge’ element in the phylogenetic tree, and
use.root.edge = TRUE, then it is assumed that it has a
biological meaning and is counted as a branch length, and the root is
counted as a speciation event; otherwise the number of speciation
events is the number of nodes - 1.
The standard-error of lambda is computed with the second derivative of the log-likelihood function.
An object of class "yule" which is a list with the following components:
lambda |
the maximum likelihood estimate of the speciation (birth) rate. |
se |
the standard-error of lambda. |
loglik |
the log-likelihood at its maximum. |
Emmanuel Paradis
branching.times, diversi.gof,
diversi.time, ltt.plot,
birthdeath, bd.ext, yule.cov
This function fits by maximum likelihood the Yule model with covariates, that is a birth-only model where speciation rate is determined by a generalized linear model.
yule.cov(phy, formula, data = NULL)yule.cov(phy, formula, data = NULL)
phy |
an object of class |
formula |
a formula specifying the model to be fitted. |
data |
the name of the data frame where the variables in
|
The model fitted is a generalization of the Yule model where the speciation rate is determined by:
where is the speciation rate for species i,
are species-specific
variables, and
are parameters to be estimated. The term on the left-hand side above
is a logit function often used in generalized linear models for
binomial data (see family). The above model can
be written in matrix form:
The standard-errors of the parameters are computed with the second derivatives of the log-likelihood function. (See References for other details on the estimation procedure.)
The function needs three things:
a phylogenetic tree which may contain multichotomies;
a formula which specifies the predictors of the model described
above: this is given as a standard R formula and has no response (no
left-hand side term), for instance: ~ x + y, it can include
interactions (~ x + a * b) (see formula
for details);
the predictors specified in the formula must be accessible to
the function (either in the global space, or though the data
option); they can be numeric vectors or factors. The length and the
order of these data are important: the number of values (length) must
be equal to the number of tips of the tree + the number of nodes. The
order is the following: first the values for the tips in the same
order than for the labels, then the values for the nodes sequentially
from the root to the most terminal nodes (i.e., in the order given by
phy$edge).
The user must obtain the values for the nodes separately.
Note that the method in its present implementation assumes that the
change in a species trait is more or less continuous between two nodes
or between a node and a tip. Thus reconstructing the ancestral values
with a Brownian motion model may be consistent with the present
method. This can be done with the function ace.
A NULL value is returned, the results are simply printed. The output
includes the deviance of the null (intercept-only) model and a
likelihood-ratio test of the fitted model against the null model.
Note that the deviance of the null model is different from the one
returned by yule because of the different parametrizations.
Emmanuel Paradis
Paradis, E. (2005) Statistical analysis of diversification with species traits. Evolution, 59, 1–12.
branching.times, diversi.gof,
diversi.time, ltt.plot,
birthdeath, bd.ext, yule
### a simple example with some random data data(bird.orders) x <- rnorm(45) # the tree has 23 tips and 22 nodes ### the standard-error for x should be as large as ### the estimated parameter yule.cov(bird.orders, ~ x) ### another example with a tree that has a multichotomy data(bird.families) y <- rnorm(272) # 137 tips + 135 nodes yule.cov(bird.families, ~ y)### a simple example with some random data data(bird.orders) x <- rnorm(45) # the tree has 23 tips and 22 nodes ### the standard-error for x should be as large as ### the estimated parameter yule.cov(bird.orders, ~ x) ### another example with a tree that has a multichotomy data(bird.families) y <- rnorm(272) # 137 tips + 135 nodes yule.cov(bird.families, ~ y)
This function fits by maximum likelihood the time-dependent Yule
model. The time is measured from the past (root.time) to the
present.
yule.time(phy, birth, BIRTH = NULL, root.time = 0, opti = "nlm", start = 0.01)yule.time(phy, birth, BIRTH = NULL, root.time = 0, opti = "nlm", start = 0.01)
phy |
an object of class |
birth |
a (vectorized) function specifying how the birth (speciation) probability changes through time (see details). |
BIRTH |
a (vectorized) function giving the primitive of
|
root.time |
a numeric value giving the time of the root node (time is measured from the past towards the present). |
opti |
a character string giving the function used for
optimisation of the likelihood function. Three choices are possible:
|
start |
the initial values used in the optimisation. |
The model fitted is a straightforward extension of the Yule model with
covariates (see yule.cov). Rather than having
heterogeneity among lineages, the speciation probability is the same
for all lineages at a given time, but can change through time.
The function birth must meet these two requirements: (i)
the parameters to be estimated are the formal arguments; (ii) time is
named t in the body of the function. However, this is the
opposite for the primitive BIRTH: t is the formal
argument, and the parameters are used in its body. See the examples.
It is recommended to use BIRTH if possible, and required if
speciation probability is constant on some time interval. If this
primitive cannot be provided, a numerical integration is done with
integrate.
The standard-errors of the parameters are computed with the Hessian of the log-likelihood function.
An object of class "yule" (see yule).
Emmanuel Paradis
branching.times, ltt.plot,
birthdeath, yule, yule.cov,
bd.time
### define two models... birth.logis <- function(a, b) 1/(1 + exp(-a*t - b)) # logistic birth.step <- function(l1, l2, Tcl) { # 2 rates with one break-point ans <- rep(l1, length(t)) ans[t > Tcl] <- l2 ans } ### ... and their primitives: BIRTH.logis <- function(t) log(exp(-a*t) + exp(b))/a + t BIRTH.step <- function(t) { out <- numeric(length(t)) sel <- t <= Tcl if (any(sel)) out[sel] <- t[sel] * l1 if (any(!sel)) out[!sel] <- Tcl * l1 + (t[!sel] - Tcl) * l2 out } data(bird.families) ### fit both models: yule.time(bird.families, birth.logis) yule.time(bird.families, birth.logis, BIRTH.logis) # same but faster ## Not run: yule.time(bird.families, birth.step) # fails yule.time(bird.families, birth.step, BIRTH.step, opti = "nlminb", start = c(.01, .01, 100))### define two models... birth.logis <- function(a, b) 1/(1 + exp(-a*t - b)) # logistic birth.step <- function(l1, l2, Tcl) { # 2 rates with one break-point ans <- rep(l1, length(t)) ans[t > Tcl] <- l2 ans } ### ... and their primitives: BIRTH.logis <- function(t) log(exp(-a*t) + exp(b))/a + t BIRTH.step <- function(t) { out <- numeric(length(t)) sel <- t <= Tcl if (any(sel)) out[sel] <- t[sel] * l1 if (any(!sel)) out[!sel] <- Tcl * l1 + (t[!sel] - Tcl) * l2 out } data(bird.families) ### fit both models: yule.time(bird.families, birth.logis) yule.time(bird.families, birth.logis, BIRTH.logis) # same but faster ## Not run: yule.time(bird.families, birth.step) # fails yule.time(bird.families, birth.step, BIRTH.step, opti = "nlminb", start = c(.01, .01, 100))
This function plots simultaneously a whole phylogenetic tree (supposedly large) and a portion of it.
zoom(phy, focus, subtree = FALSE, col = rainbow, ...)zoom(phy, focus, subtree = FALSE, col = rainbow, ...)
phy |
an object of class |
focus |
a vector, either numeric or character, or a list of vectors specifying the tips to be focused on. |
subtree |
a logical indicating whether to show the context of the extracted subtrees. |
col |
a vector of colours used to show where the subtrees are in the main tree, or a function . |
... |
further arguments passed to |
This function aims at exploring very large trees. The main argument is a phylogenetic tree, and the second one is a vector or a list of vectors specifying the tips to be focused on. The vector(s) can be either numeric and thus taken as the indices of the tip labels, or character in which case it is taken as the corresponding tip labels.
The whole tree is plotted on the left-hand side in a narrower sub-window (about a quarter of the device) without tip labels. The subtrees consisting of the tips in ‘focus’ are extracted and plotted on the right-hand side starting from the top left corner and successively column-wise.
If the argument ‘col’ is a vector of colours, as many colours as the
number of subtrees must be given. The alternative is to give a
function that will create colours or grey levels from the number of
subtrees: see rainbow for some possibilities
with colours.
Emmanuel Paradis
plot.phylo, drop.tip,
layout, rainbow,
grey
## Not run: data(chiroptera) zoom(chiroptera, 1:20, subtree = TRUE) zoom(chiroptera, grep("Plecotus", chiroptera$tip.label)) zoom(chiroptera, list(grep("Plecotus", chiroptera$tip.label), grep("Pteropus", chiroptera$tip.label))) ## End(Not run)## Not run: data(chiroptera) zoom(chiroptera, 1:20, subtree = TRUE) zoom(chiroptera, grep("Plecotus", chiroptera$tip.label)) zoom(chiroptera, list(grep("Plecotus", chiroptera$tip.label), grep("Pteropus", chiroptera$tip.label))) ## End(Not run)